Sign in or Join FriendFeed
FriendFeed is the easiest way to share online. Learn more »

Jen Dodd › Likes

Michael Nielsen
Request regarding conference microblogging
This is a request in regard to conference microblogging on FF, e.g., http://friendfeed.com/rooms... A frequent frustration of participants is that there is comment duplication, as multiple people post the same material within seconds of each other. This is happening a lot, and is difficult to eliminate on a large scale. Any chance of seeing comments as they are drafted in real time? It would make FF much more useful for conference microblogging. - Michael Nielsen
Incidentally, the room may be of interest as an application of FriendFeed. With 5-10 people simultaneously microblogging we're getting close to complete conference liveblogging coverage, including links to relevant URLs, other materials, etc. Thankyou for a wonderfully flexible service! - Michael Nielsen
Speaking as someone microblogging for the first time, the possibility of simultaneous comments was a barrier to getting started - some of my first microblogs were duplications, which was pretty embarrassing. - Jen Dodd
This feature should be in a feature of Rooms for sure. I was thinking about this today too. - Roger Kondrat
I was irked when the TC50 Room was only postable for TechCrunch staff. - Daniel J. Pritchett
Perhaps it is useful for presenters at conferences to have an assistant scribe their key points as they themselves speak. (real time) This would probably be best done via the account of the speaker. The speaker can then later respond to the discussions that she started as a result of her presentation. And even more interesting... she could distribute the conversation along with the slides distributed via slideshare. - Bart LePoole
Maxine
Event - Science Communication Conference on Nature Network - http://network.nature.com/hubs...
From Matt Brown. The Science Communication Conference will take place on 22 and 23 June 2009 at Kings Place, central London. - Maxine from Bookmarklet
Extremely likely I'll be there - enjoyed the last few at the IET building. There's a lecture at IET by the curator from Greenwich Maritime museum coming up which looks interesting. Not all that surprisingly it's something to do with time. - Jo Brodie
Kings Place is literally next door to Nature, so if anyone is going, let me know. - Maxine
I may be able to get there, since I'll already visiting London around then for the World Conference of Science Journalists the following week http://www.wcsj2009.org/ - Jen Dodd
I like the "science communication" angle. Since I'm not a working scientist, I would be much more comfortable going to an event under a "communication" scope, I don't consider myself a "science blogger", but I do consider my blog to include science communication. - Richard Akerman
Just a couple days after OAI6 at CERN too... - Richard Akerman
I would say at our science blogging conference in London in August, Richard, maybe one-third to half of the people there weren't scientists - they were librarians, publishers, journalists, editors, book authors, policy people, educators et al.- I was quite surprised about that. - Maxine
Just noticed CFP deadline is *tomorrow* Friday 21 November 2008. http://www.the-ba.net/the-ba... - Richard Akerman
@Richard Akerman Yay for science communication. I'm neither a working scientist nor a science blogger (of course I learn quite a lot of science from them). I'm not quite a librarian either although I do work in a science library. But I am a science communicator. My understanding of SciBlog08 is that it was for people interested in communicating (or reading) science via blogs :) - Jo Brodie
Very true, Jo. But it did broaden out to "Web 2.0 in general" also - eg the open lab notebook/wiki session. - Maxine
Yes good point, it's where I first heard of FriendFeed. I chatted over lunch (very nice lunch!) to David Bradley about it and decided to give it a go later. Glad I did. - Jo Brodie
I like Friend Feed too, as you can probably tell ;-). I heard of it on the run-up to the conference and would not have persevered with it (because of the cancaphony of everyone's twitter etc etc) but for the "hide" option which someone kindly explained to me; and for the fact that we had this FF room on the run-up to the conference set up by Matt Wood, so I could see the usefulness... more... - Maxine
I agree, Maxine. I'd really like to see more science outreach people in here. - Jen Dodd
I like "science communication", a better term for what most of us are interested in than "science blogging". - Martin Fenner
well, if I land this job I'm going for in London (or the Nature one...) I shall try to make it... - Richard P Grant
Good luck with the application(s) :-) - Jo Brodie
John Dupuis
That was amazing! - Michael Nielsen
Yes, it certainly was. Direct link here: http://news.bbc.co.uk/2... - John Dupuis
Wow. When I was a kid, the record was something like 22,000 -- all set up by the same guy. - Dave Munger
I can't imagine -- what if somebody sneezes after 3.5 million are set up? - John Dupuis
Yikes. I hope they don't allow little children into the setup areas! - John Dupuis
I love everything about this story and associated thread. Do feel bit bad for the sparrow back in '05. - Euan
Pierre Lindenbaum
"Science Week-End in France" http://www.fetedelascience.fr/
Do you know if this is this an anual thing? It looks pretty big. - Jen Dodd
Yes this is annual. Laboratory and biotechs open their door. I was always asked to participate but I've never joined. - Pierre Lindenbaum
Jill O'Neill
Yahoo! Glue Finally Comes to the US and It's Awesome - http://www.readwriteweb.com/archive...
This is rather cool. Don't know secifically which user base requires it, but it is a nice display of results from which one can pick and choose. - Jill O'Neill
Ah. Yahoo Glue (multi search results) not = Adaptive Blue Glue http://getglue.com/ (social web) - I was confused there for a second. - Richard Akerman
I actually like Adaptive Blue's Glue more. That one makes sense to me on a practical level. - Jill O'Neill
Sabine Hossenfelder
is typing "coauthorship". Spellchek suggests: "coauthor ship" or "co author's hip".
Jean-Claude Bradley
John Dupuis
Kinda fun to have provoked some angst among some LIS students: http://cashewdani.livejournal.com/463543... - John Dupuis
best quote from the angst: "the ambitious nature of some people (and by some i mean like 4) are ruining the standards for everyone else." *snerk* - Betsy
I'm concerned about the commenter who basically tries to denigrate her own chosen area (school librarian) by suggesting that the advice is for some other (more advanced?) type of librarian. School librarians/media specialists need to be awesome! As for the advice, I thought it was good. - Katy S
even *I* found this boggling: "you shouldn't even need to go to graduate school to become a librarian (i mean for christ's sake, you should just be able to read and get the goddamn job)" srsly? (altho I find scoble's advice a little boggling too. as in waaay boggling, especially when he's looking for an (underpriced in this neck of the woods) ADMINISTRATIVE ASSISTANT. sorry for the all caps, I'm still boggling.) - Elaine is trying to write
"I just give a damn about what I do." Dorothea FTW. - Elaine is trying to write
I think what annoyed me the most was the assumption that a job would follow automatically and without effort at the magical confirmation of librarian status. Sure a lot of the suggestions were over the top, but really, picking anyone of the suggestions and running with it would make someone really stand out and wouldn't be that hard. - John Dupuis
That person's response just makes me want to start a flame war. - Laura H.
I don't think your perspective is off at all. I don't think it's that hard for someone to pull together a simple site, even if it's only showcasing the course work that they did and has a basic online CV. - John Dupuis
It's also interesting that the livejournal has been closed to the public now. Anyone out there with a livejournal login to see what they're saying? - John Dupuis
It's been friends-locked. - Betsy
Curses! I guess they wouldn't friend me if I signed up to lj... - John Dupuis
John's right that it isn't hard to put up something basic online. I am technologically-impaired compared to many folks and I still managed to put together an online teaching portfolio. - Katy S
There was a follow-up that appeared to be non-friends-locked for a very brief time. The gist was that the person felt like a dope for not friends-locking the post in the first place, and that much of her rant came from the fact that she was unhappy with her mickey mouse library school. To which I can relate. Sounds like it may have been a useful learning experience. - Your Neighbor Steve
Agreed. But I think we are all a little unproductive from time to time. If this is the stupidest thing she ever does online, we should all be so lucky. - Your Neighbor Steve
*headdesk* - Your Neighbor Steve
Recently I was looking at a bunch of CVs for a workstudy position here and was actually pleasantly surprised how accomplished many of the ugrads were and how polished their CVs were. That was about 50%. - John Dupuis
There were also a fair number where the cover letters were basically cut and paste from a variety of other applications that they were doing and bore no resemblance to the job on offer. Or that misspelled their cutesy/weird email addresses two or three different ways in different places. - John Dupuis
Michael Nielsen
The FriendFeed "Like" button.
The Like button is definitely one of the best features of FF. - Jen Dodd
John Dupuis
Shirley Wu
Corpus callosum: 1st edition of open science round-up - http://shirleywho.wordpress.com/2008...
Great job, Shirley! - Bill Hooker
Wonderful stuff - Deepak Singh
**** meaning 5 stars Shirley !! - Graham Steel
Many, many stars - that is a brilliant and pretty comprehensive summary of the last few months - Cameron Neylon
comprehensive. great work. - Richard Akerman
Thanks everyone! - Shirley Wu
Michael Nielsen
Killing myself laughing at today's frrriendfeed icon. Yarrr!
And now some items say: 'and 2 other mateys liked this". Yarrrrr! - Dan Gezelter
Mark Tovey
"Books in this space that you'd recommend?"
sixty days and counting, stanley kim robinson - Paul Guinnessy
Vernor Vinge's Rainbows End? - Richard Akerman
Here Comes Everybody by Clay Shirky - Jen Dodd
Standage: The Victorian Internet - Greg Wilson
+1 Here Comes Everybody - Richard Akerman
"Wealth of Networks" by Yochai Benkler - Deepak Singh
+1 Rainbows End - Jen Dodd
+1 Wealth of Networks - Hilary
"Here Comes Everybody" by Clay Shirky; anything by Lawrence Lessig; "Wikinomics" by Tapscott and Williams (interesting, but worth skimming some bits), "Crowdsourcing" by Jeff Howe is pretty good, from the journalist who coined the term (Google for the author's website, where it's available in draft); I'm looking forward to Tara Hunt's book about Whuffie, to be released shortly; +1 on the Vinge; +1 on the Benkler; +1 on the Tovey :-). - Michael Nielsen
Everything is Miscellaneous by David Weinberger and +1 to Here Comes Everybody - John Dupuis
The Future of Reputation by Daniel Solove and The Big Switch by Nicholas Carr are both good news/bad news books that are worth reading - John Dupuis
+1 big switch - Deepak Singh
Community by Peter Block - Jen Dodd
Ambient Findability by Peter Morville - John Dupuis
Dreaming in Code by Scott Rosenberg is a terrific book about how hard it is to build good programs, building on Greg Wilson's talk. - John Dupuis
Mancur Olson's 1965 book "The Logic of Collective Action" describes a class of economic problems that (from a modern perspective) includes the question "Why don't scientists adopt web 2.0?" It's fascinating, and well worth taking a look at. - Michael Nielsen
Christine Borgman, "Scholarship in the Digital Age", has an enormous amount of useful detailed information. - Michael Nielsen
+1 Scholarship in the Digital Age, it is very comprehensive on the more political and social aspects, but it doesn't cover the technology aspect much. - Richard Akerman
The Cathedral & the Bazaar: Musings on Linux and Open Source by an Accidental Revolutionary By Eric S. Raymond - Sol Lederman
Paul Guinnessy
final discussion
M: instead of considering a triangle of science, society and technology, suggests its a two way link between science and society - Paul Guinnessy
Question: What is the most striking thing that you've learnt in the last week? - Paul Guinnessy
Question 2: How will Science21 impact your career or professional life? - Paul Guinnessy
Chad: Hadn't thought about open access, its not about access to papers, its about access to what the papers say that's the problem. John Moslinky talked about these tools in open access journals that allows you to find related articles that can explain topics, language in the papers - Paul Guinnessy
Chad: Impact of John Willinsky's talk about Public Knowledge project making papers accessible to people - Cameron Neylon
Chad: hadn't thought about the open notebook idea, and its sounds like an attractive idea, a very practical way to stay in touch with the lab while out of the office. Previously I had never thought about it, now keen to investigate. - Paul Guinnessy
feedback from the floor: what about people stealing or reusing your work? Chad, not really a problem in his field - Paul Guinnessy
more of an education problem that a technology problem. That's the problem. (Wilson) - Paul Guinnessy
Cameron: "The primary person you are making access to is your own" Security is hard, the rest of the tools are not, so if it makes your life easier, I think people will move towards this model faster. - Paul Guinnessy
David: Surprised by looking back at his experience in physics, 10 years ago met a person who posted to arxiv after communicating via email for months. Couldn't complete papers until he had flown and met in person. Is there some way the dense communication that you have in person we replicated through technology? David is not sure. David was shocked that Cameron was advising a student miles away from where he's based? - Paul Guinnessy
Wilson: Is this a generation thing? - Paul Guinnessy
Cameron: there is still some tangible experience you get in person, but perhaps a mixture of all these tools (blogs, email, etc..) mixed together could replace this experience. - Paul Guinnessy
Wilson: 30 years ago it would rude to answer a phone at dinner. Now technology has changed the rules because we fragment our time differently that in the past. - Paul Guinnessy
M mentions the friend feed - Paul Guinnessy
Cameron: depends on what your expectation are. 2nd life your expectations is low because its crude, but the ability to see where people are looking etc.. can be valuable, even if its really just a bunch of text commands - Paul Guinnessy
Garrett et al's paper is http://jcmc.indiana.edu/vol13... - Greg Wilson
J: emailing tex files back and forth eventually becomes unproductive (see his talk). Wiki and IM is better. Took one away, it doesn't work, but synergy is good between the two. - Paul Guinnessy
Michael gives examples of Tapscott and Williams leaving Skype on all day; "Don, are you there?" - Mark Tovey
David: timescales are important. - Paul Guinnessy
IM is very low latency but also low bandwidth - Mark Tovey
Cameron: different media have different timeframes. e.g. C is a day late on a google doc paper, reason is because he hasn't been nagged by email or phone. - Paul Guinnessy
Wilson: grabbed the third floor, and it was several weeks before the employees realized that there was a new group. - Mark Tovey
Wilson: one of his start ups is on two floors which cut commuication by 90%. They installed 24/7 webcams in all the coffee room. Eventually all the staff had all their meetings in this room. When they expanded again it took several weeks before people realized that the staff had expanded to another floor because it just looked like another room on the system. Wilson is very keen to see this in a lab. - Paul Guinnessy
Wilson: potential experiment -- sheet of virtual glass between two labs - Mark Tovey
Greg - what was the company? - Jen Dodd
David: Need to encourage outreach to the public. Previously his had been in old media, now he may consider new media. - Paul Guinnessy
I would enjoy reading David's blog! - Jen Dodd
garrent: pleased that there was interaction between groups. Thought that journals were dinosaurs, but after seeing Timo's Nature talk, realized that they were trying to facilitate communication between scientists. - Paul Guinnessy
Harry's blog would be interesting as well! - Cameron Neylon
garrent: what is science socially? Never thought of science as a social construct before. - Paul Guinnessy
garrent: pleased at the interactions outside of conferences - Paul Guinnessy
+1 on Harry's blog - although I could imagine it might sometimes be a bit too close to the bone for physicists to hear what they're really like :) - Jen Dodd
T: the one thing that was missing what impact from people outside science. It would be nice to see how people use tools etc.. in their field and want lessons we can learn with that. - Paul Guinnessy
Wilson says it might be useful to invite the person who created Toronto's freedom of information act that means Wilson can't use gmail to contact students. It would apply some legal framework to the privacy concerns connected to scientific data, research, and the spread of knowledge. - Paul Guinnessy
s/Toronto/Ontario/g - Greg Wilson
Wilson: US navy and marine corp are doing good stuff on learning stuff quickly, might learn from that experience. - Paul Guinnessy
Sabine: this workshop was an experiment and I'm glad that there was interactions between the participants considering their varied background - Paul Guinnessy
I suggest concentrating on the audio. If that can be cleaned up then that's good enough. You can always add photos to the audio cues to get a more visual representation. - Paul Guinnessy
Agreeing with Paul... - Michael Nielsen
Sol Lederman
Leaving at 1:00 Friday
I'm heading back to the states after lunch today. I want to say that this has been a great conference. I've really enjoyed the experience and I've learned a tremendous amount. Thank you, everyone, for your great presentations, your great ideas, your enthusiasm for making a difference and your great friendliness. Sabine -- you did an outstanding job in the organization. If any of you are ever in Santa Fe, look me up. - Sol Lederman
I share the view that this has been a quite beneficial meeting, and wish to thank all who helped in its organization. Sorry I cannot stay through the wrap-up. - carolh
Thanks for coming and making this event such an interesting and stimulating meeting! - Sabine Hossenfelder
Michael Nielsen
My talk today will be pretty heavily based on my blog post http://michaelnielsen.org/blog... Some of you have already read this deeply (and, in many cases, provided helpful feedback), in which case you may wish to go feed the ducks or something! I'll try to get the slides up in advance, but I do tend to tinker to the last minute, so no promises! - Michael Nielsen
Thankyou, Eva :-). Doing your bit for open science (or for the examples in my talk, anyway...) - Michael Nielsen
We could try and take pictures of ducks... - Cameron Neylon
Liking this because of the conversation about ducks ;-) - Jen Dodd
Eva - I wasn't imagining people microblogging my talk in this thread. Just wanted to warn people about the content... - Michael Nielsen
because Beth Noveck has just finished giving a brilliant talk...http://friendfeed.com/e... - Cameron Neylon
:-) - Jen Dodd
Those are Canada Geese, not Ducks. Cute in principle, but create really horrible waste in practice. Huuuge flocks in Toronto. I was surprised that P.I. hasn't cleaned around the pool. - Barry Wellman
Paul Guinnessy
"Michael A. Nielsen: Cultural openness and online innovation in science"
I was expecting someone taller... - Greg Wilson
Chad's still outside... - Cameron Neylon
Doing the story on Hooke's Law - Cameron Neylon
Talk based on earlier blog post --- url? - Greg Wilson
Greg: see Chad's post above - Jen Dodd
revealing results as ciphers so that priority could be claimed without revealing the underlying findings - Cameron Neylon
What if the human genome were published as an anagram? - Cameron Neylon
Imagine Human Genome published as anagram-- aaaaaaacccccccgggggggttttt - Chad Orzel
i the age of the alchemists the secretive culture was the logical results of their being no personal gain in making results public - Cameron Neylon
around end of 1600s people began subsidising the sharing of discoveries - Jen Dodd
Government's etc decided the subsidise the sharing of discoveries - not the making of them - Cameron Neylon
By Faraday's time, work was not complete without publishing. Roughly 1830. - Chad Orzel
faraday's advice to Crooke. 'Work. Finish. Publish.' - Cameron Neylon
As a result we have constructed a shared long-term memory. - Jen Dodd
publication has not changed much in 300 years - Cameron Neylon
opportunity to day to create a collective short term working memory - Cameron Neylon
Internet offers the opportunity to improve our collective long-term memory. - carolh
Two ideas: Internet improving short-term memory; Internet allowing new ways of collaborating - Chad Orzel
most online tools remain niche application even when they'd be really useful if broadly adapted - Cameron Neylon
JoVE is about improving the sharing of tacit knowledge, as discussed in Harry Collins's talk. - Jen Dodd
Kasparov versus the world on wikipedia: http://en.wikipedia.org/wiki... - Jen Dodd
Linux however would have never been the success that its been if Torvald hadn't been financially supported to work on it (not in the beginning but later on once it took off) - Paul Guinnessy
In this game, one in forty people cast a vote for a move that was not just bad, it was illegal. - Jen Dodd
People voted for move that wasn't only bad, but illegal. - Chad Orzel
And now, the depressing part... Failures online - Chad Orzel
people that not only do you not know, but people you don't know you don't know... - Mark Tovey
Nature open peer review: http://www.nature.com/nature... - Chad Orzel
science-advisor still around but not popular for commenting - Paul Guinnessy
Many other failed comment sites. - Jen Dodd
physics comments for arxiv failed in 2006 - Paul Guinnessy
Another unmentioned example: SciRate: http://scirate.com/ - Chad Orzel
Wikipedia: Few scientists involved in early days - Chad Orzel
note: In physics, review comments are usually closed only for a limited time, usually 50 years, then historians are allowed to access them - Paul Guinnessy
Robert Boyle's first publication was advocating open publication. - Mark Tovey
wilikpedia's budget is $4.6 million but that doesn't include a lot of bandwidth costs etc.. which are donated to the foundation. Realistically its probably closer to $35 million, which is still pretty small. - Paul Guinnessy
"We need to get people's ideas out of their heads and onto the network" - Mark Tovey
The problem with Wikipedia isn't just the lack of reward for writing articles, it's also the culture of Wikipedians. - Chad Orzel
extreme openness - Mark Tovey
open licensing for information reuse machine readable open API's - Mark Tovey
But was this the case in the early days? - Jen Dodd
How to achieve? 1. Superb online tools 2. Cause cultural change. - Mark Tovey
google: moving from a 10-result to 30 result page change loading times from 0.4 to 0.9 seconds and decreased hits and web revenues by 20% - Paul Guinnessy
1 requires a deep understanding of how scientists work, as well as superb design. - Jen Dodd
I'm not sure I agree that this is due to scientific culture in particular-- there are lots of examples of nifty online tools and ideas that failed for no obvious reason. - Chad Orzel
There are plenty of examples showing the user interfaces are a deep and difficult problem - but there are examples of cultural problems - Cameron Neylon
spires keeps tracks of citations both between journals and Arixv. - Paul Guinnessy
spires allows physicists to convincingly demonstrate that your work is having a high impact without publishing in a conventional peer-reviewed journal. - Paul Guinnessy
"the gray literature" (referring to unpublished preprints etc.) --- anyone have a cite for the term? - Greg Wilson
How about wikipedia: http://en.wikipedia.org/wiki... - Jen Dodd
Garrett Lisi, Grisha Perelman, examples of major papers never even submitted - Chad Orzel
Garrett Lisi says he chose not to submit his paper on an Exceptionally Simple Theory of Everything to a journal, and just left it on the arXiv. - Jen Dodd
American Library Association paper about gray literature resources in all disciplines with a brief description of the term (a bit out of date, 2004): http://www.ala.org/ala... - Bonnie Swoger
My blog post about being a lousy plumber: http://www.steelypips.org/princip... - Chad Orzel
innocentive is a way of collaborating in science by chucking questions out there with $1 million prize if you solve it. - Paul Guinnessy
most problems were solved by people working outside their expertise (Harvard Study 2006) and are solved quickly. - Paul Guinnessy
innocentive not a good scale-based model for basic research - Paul Guinnessy
Paul Guinnessy
"Barry Wellman: Networked Individualism and the Triple Revolution: Networks, Internet and Mobility."
Email as frequent with ties 3km and 3000km. Then it drops off, if I understood correctly(?) - Michael Nielsen
That's what I understood, too. I'd guess it's related to country size (ie, size of the US). - Jen Dodd
75% North Americans have a computer, most of those Internet access, mostly in badly decorated basements. - Chad Orzel
"My wife and I shared a mobile phone for a while, until we realized we mostly wanted to talk to each other." - Michael Nielsen
connectivity is to you not your household unit for the first time - Paul Guinnessy
General comments on historical context of social networks. - Jen Dodd
Changing structure of networks. - Michael Nielsen
Now, get support (ie, financial) from different people than those you have beer with. - Jen Dodd
Trivia: Most overloaded people in world are adult sisters of adult brothers. - Chad Orzel
Social capital from boutiques and not general stores - Michael Nielsen
@Chad: what's "overloaded"? I missed that... - Jen Dodd
individuals manipulate and change their network units rapidly to adapt to changing social situations and needs - Paul Guinnessy
"People function more as networked individuals and less as group members." - Jen Dodd
People are more networked than Putnam thought, but not as group members; go out to events as individuals. - Michael Nielsen
places (church, school, work etc..) less important, communication are can be person to person due to these new tools - Paul Guinnessy
Claim: networked individualism leads to fewer weak ties, and so less caring for strangers. - Michael Nielsen
Trivia: 14% of Americans no longer have land-line phones - Chad Orzel
Aside: it costs polling companies 3 times as much to call cellphones than landlines. - Jen Dodd
little context using a phone, personal view: you lose 85% of communication when you rely on audio cues, not visual cues, and you lose another 80-odd% when you're texting. - Paul Guinnessy
personal time with family less, but communication via email, phone, txting up - Paul Guinnessy
Claims relationships getting more specialized. It would be absolutely fascinating to dig into a lot of the background on many of these claims. - Michael Nielsen
specialized social, emotional and economical support. - Bonnie Swoger
Graph: increased number of in-person meetings from 2002-2007 - Chad Orzel
Shift from spatial propinquity to shared interests. - Michael Nielsen
Networked individuals create new communities around shared interests: not surprising to bloggers and Usenet veterans - Chad Orzel
"Virtual Friends" only 6-ish out of 250-300 friends (NA avg.) - Chad Orzel
Jane Jacobs: people working at home on computers are more likely to keep an eye on the street and become more locally aware. - Jen Dodd
changing role of jobs, particularly technological jobs, increases the likelihood that you will work at home. What about scientists? - Paul Guinnessy
papers cite fewer references because of tools such as google scholar - Paul Guinnessy
Paul - There's been a lot of debate and skepticism about the claim. It's from a paper in Science a few months back. Evans, I think(?) - Michael Nielsen
isn't this also a cost issue? You couldn't build some of these networks in the past because the cost (either personal or monetary) was too high? - Paul Guinnessy
The recent paper on citations from Science (behind a paywall): http://dx.doi.org/10... - Bonnie Swoger
The "Does Distance Matter" paper is on my website. (Probably out next year in Urban Studies). It was done with Toronto data (not US). The distance parameters probably would change drastically with crossing national borders in small countries. But note that Canada-US connections are as strong as Canada-Canada. Barry - Barry Wellman
Jen wrote above: "Jane Jacobs: people working at home on computers are more likely to keep an eye on the street and become more locally aware." Just to be clear: Jane was a great urban planner, but she wrote this pre-computers in her 1962? book, The Death and Life of Great American Cities. Barry - Barry Wellman
Michael Nielsen
Beth Noveck: From Science 2.0 to Government 2.0
Tunisian prison map - opening up govt abuses - Michael Nielsen
Changing the nature of expertise and the single point of failure - Michael Nielsen
"We're putting too much decision making power n the hands of a single individual" - Michael Nielsen
said ted steven's - Paul Guinnessy
I'm rather sympathetic to Stevens on this, must admit... it's just a metaphor. - Michael Nielsen
Chris Mooney: http://scienceblogs.com/interse... The book she mentioned is here: http://www.amazon.com/exec... - Chad Orzel
Ethan Zuckerman on the importance of cute animal pictures: http://www.ethanzuckerman.com/blog... - Chad Orzel
Talks about the importance of chunking governance into small chunks. C.f. Benkler on the importance of this in open source. - Michael Nielsen
Importance of teams, "group-based participation" maybe like Clay Shirky says? - carolh
Peer-to-patent project: this is the talk within the talk - Michael Nielsen
Peer to Patent Project -- yay! - carolh
Mozilla is only an example of participation , not governance - Paul Guinnessy
Working on 250 applications, with inventor consent - Michael Nielsen
www.peertopatent.org - Paul Guinnessy
Paul - Lots of decisions need to be made. What ships? When? What are the design goals? These are all governance issues, I think. Mozilla is even split into two parts (Mozilla Foundation and Mozilla Corporation) - the Foundation is, I believe, soley concerned with governance of Mozilla Corporation. - Michael Nielsen
Patent office reverted to quasi-registration system: this is a major problem with people patenting perpetual motion machines - Chad Orzel
Wow! This is the same reason many journals started to become peer reviewed! E.g., Nature started peer review in 1967 because of a backlog. - Michael Nielsen
Why has it taken so long to get to this point with patents, when peer review of paper happened so long ago? - Jen Dodd
Patent Office does prior art searches using internet archive (not Google, for privacy concerns). The archive is great, but it's not much chop at search... - Michael Nielsen
Patent Office forbids Google-- some examiners search in Internet Archive (also get date stamp that way) - Chad Orzel
Internet Archive really is tracking USPTO search activity - Chad Orzel
15 hours is the review time for prior art for patents. - Michael Nielsen
Question: Why have they only scaled to 400 patents, after several years? - Michael Nielsen
Question: Who is actually volunteeting their patents for review? Presumably it's not the patent trolls... - Michael Nielsen
http://peertopatent.org/ Community patent review ala web 2.0 - Sol Lederman
Apparently people who submit to this process get their applications reviewed first. - Michael Nielsen
Argues that inventors have benefit of greater certainty that their patent is indeed original. Would be nice to know after time whether there are fewer later challenges to patents that have gone through this process. - Simeon Warner
Not replacing patent examiner, just providing extra information, while keeping quality control. - Chad Orzel
Participation very granular. Most people just do things once or twice. - Michael Nielsen
30+% of volunteer commenters from CS background, but ~3% from history... - Chad Orzel
Up to 80 applications only! Very small experiment. - Michael Nielsen
40 applications, 401 discussion comments. 176 pieces of prior art. - Michael Nielsen
Very small fraction of patent traffic-- 80 applications so far, out of 400,000/year. Patent Office completed comment on 40. - Chad Orzel
European patent office interested, Japan doing it, UK designed, but yet to be deployed. - Michael Nielsen
Discussion of whether science faculty may be willing to do this for course credit. Sounds like a lot of the boundary conditions are right. - Michael Nielsen
No spam in the project. People are exceedingly well behaved, apparently. Says people self-select. - Michael Nielsen
I'll be interested to watch the video of this as I'm at the intersection of science 2.0 and government 2.0 - Richard Akerman
Jeff Howe's book has a nice treatment of Beth's work - http://crowdsourcing.typepad.com/cs... - Michael Nielsen
If she said, I missed it: How many of the 40 patents considered were granted? - Chad Orzel
I missed whether people can contribute anonymously to this? I'm guessing not? - Cameron Neylon
She has a wonderfully improbable story about how this all happened, that really probably needs to be seen on the video. - Chad Orzel
Regarding my question a few notes up, I asked her later, and she said that they don't have enough information yet to say whether the applications through this program are accepted at a rate different from the usual process. - Chad Orzel
Paul Guinnessy
Discussion: "Power and Progress: Democracy and Ethics in Science"
Moderation: Steve Weinstein Panelists: Harry Collins, David Kaiser, Lee Smolin - Paul Guinnessy
Demarkation problems: what defines science, what defines fields of science? - Chad Orzel
Collins: Who is producing scientific expertise? - Paul Guinnessy
Collins: If anything goes, Steve Fuller is entitled to go defend intelligent design in Dover, and we've got to find a way to stop that. - Chad Orzel
Kaiser: How do we determine "good faith"? - Chad Orzel
membership of a science society used to be a way of defining some expertise in science (particularly in europe in which you could only get in through your peers). That I think is changing. - Paul Guinnessy
Smolin: ID advocates are not in good faith, use evidence dishonestly. - Chad Orzel
Lee: deciding who's "in good faith" is not always straightforward, but you can usually tell when you've engaged with them for a while, and tried to solve a problem together. - Jen Dodd
Collins: "Can you think of any ethical code where bad faith is recommended?" Smolin: "Yes." - Chad Orzel
Collins: If honesty and sincerity is the standard, then it's much too fragile. - Chad Orzel
Jon Walgate: the legal system is an example of a system where bad faith is enshrined as a principle. - Jen Dodd
"Can you think of any ethical code where bad faith is recommended?" The case for invading iraq? - Paul Guinnessy
Rafael Sorkin: Plato recommended bad faith - governors should lie to people in lower classes in order to keep them in line. - Jen Dodd
I diagree with Walgate on the legal system-- even defense advocates are expected to argue in "good faith," in that they are not allowed to commit perjury, tamper with evidence, etc. - Chad Orzel
But I think it's fair to say that the legal system is built on the _assumption_ that people are not necessarily dealing in good faith. - Jen Dodd
There's a real difference in goals here, I think (and Smolin has just started saying this): Collins is obsessed with excluding bad science, Smolin is aiming for a warmer, fuzzier view of things. - Chad Orzel
Much discussion about why we need criteria to demarcate science, and what those criteria should look like. - Jen Dodd
the discussion on absolutes does lead to the question of how much "bad faith" can science as a field, withstand. e.g.is there a critical point in which it could be particularly damaging? - Paul Guinnessy
Any lengthy statement can be turned into a question by ending with "...and what do you think of that?" - Chad Orzel
@Paul: it also raises the question of what sorts of things increase the motivation to act in good faith, and vice versa. - Jen Dodd
Smolin: "My peer review is whatever these guys have put in place on the arxiv." Ginsparg: "Oh, Jesus." - Chad Orzel
that can only work in string theory because the field is so small. It would be difficult for condensed matter physics for example (or look at the thousands of astronomy papers published each day). - Paul Guinnessy
I'm not sure I agree, Paul. I used to happily flip through cond-mat (although I admit it was a few years ago). - Jen Dodd
There's some question about how well cond-mat has really adopted the arxiv, though. - Chad Orzel
in applied physics you would miss 68% of the research published in the field (we have seen studies on this) - Paul Guinnessy
David: (asking Lee) the idea of funding up and coming young scientists seems like a great idea, but how does it scale to experimental scientists rather than theorists? - Jen Dodd
Lee: This has been done - see the Institute for Molecular Biology (somewhere in Europe, didn't catch where) where they set up young experimentalists with full operating budgets for a long term. - Jen Dodd
Cameron Neylon: similar schemes are heavily oversubscribed, showing how needed they are. - Jen Dodd
Examples of interesting places experimenting with novel funding structures: MRC Lab (http://www2.mrc-lmb.cam.ac.uk/). - Alex Soojung-Kim Pang
I would also include Saudi Arabia and Singapore under places experimenting with funding young scientists - Paul Guinnessy
Steve: change topic to role of "amateur experts" in science - perhaps they can only contribute in certain parts of science? - Jen Dodd
Harry: if science is broad enough to include eg a medical consultation, then clearly amateurs have a role since the patient is the authority on describing the symptoms. - Jen Dodd
Lee: Funding from a single funding source is risky for a field - Paul Guinnessy
Comments broke off here, I believe because FF was down? I couldn't post anymore, anyways. - Jen Dodd
I wondered if it was just me that couldn't update. Looks like its reliability we also need to add to the list - Paul Guinnessy
Michael Nielsen
Lee Smolin: Science as an ethical community
PI is itself an experiment in organization of science - carolh
How does (has) science work: Logical positivism, followed by Popper (falsifiability), then Kuhn (revolutions), Feyerabend (there is no scientific method) - Cameron Neylon
"as an undergraduate [Kuhn's] book was required reading in every course I took." :=) - Michael Nielsen
Feyerabend: "Name any rule a great scientist broke it (and had to break it to make any progress). - Jen Dodd
Personal aside: Feyerabend influenced me a great deal as an undergrad. I've backed off him a bit, but he's still interesting. - Michael Nielsen
most scientists are split, deeply conservative and traditional, and yet also radical - Paul Guinnessy
Smolinism - There is no scientific method. Both the scientific and the democratic processes require reasoning from shared, but incomplete, evidence to limited but ever expanding consensus. But how does this work? - Cameron Neylon
Never actually read any of these books completely - does that mean I was trained on the upsurge of the bubble? - Cameron Neylon
Lee: But while we (scientists) have to break these rules, we are also deeply conservative and trained in a tradition we deeply respect. - Jen Dodd
Analogy btw ways scientists work & decisions by democratic procedure, e.g. legal. - carolh
"Science works because scientists are members of ethical communities." ascribes to Merton - Michael Nielsen
Reminds me of the work on communities of practice by Wenger (?) et al. - Michael Nielsen
science works because scientists are members of ethical communities - i.e. it is ethical practice that is important not experimental or theoretical procedures - Cameron Neylon
"We argue in good faith from shared evidence to shared conclusions." - Jen Dodd
"Membership open to all who master relevant crafts" - carolh
"We have a high error rate, we easily fool each other, and we easily fool ourselves. Therefore we learn techniques whose primary function is to identify and root out error in our own work." - Jen Dodd
argues that we are "required to report honestly the results of our investigations". I note that there is no requirement to report all investigations however. - Simeon Warner
Views the rooting out of error as one of (the?) the primary activities. - Michael Nielsen
"The community teaches mastery over techniques intended to detect errors..." - Cameron Neylon
The open membership claim is probably somewhat controversial, given the large number of examples and accusations of race and gender bias. - Chad Orzel
"Ethical principles underlying science: 1. If an issue can be decided my people of good faith applying rational argument to publicly available evidence, then it must be regarded as so decided." - Jen Dodd
Communities of practice - http://www.ewenger.com/theory/ It seems to me that Lee is arguing that science is a set of communities of practice, with particular common properties. - Michael Nielsen
Also I wonder how you handle the lone voice in the wilderness - are they therefore encouraged to be diverse because they haven't yet, in good faith, agreed the community position - Cameron Neylon
But I very much like the centrality of the availability of evidence - Cameron Neylon
Cameron - yeah, that's a good question. - Michael Nielsen
But does this come back to defining the community - where you draw the line can determine the conclusions the community reaches - Cameron Neylon
Claim: people with a PhD from a reputable place cannot make useful contributions to science, except in rare instances. - Jen Dodd
Accreditation is necessary: Utterly disagree. Galaxy Zoo. Cornell Birding project. FoldIt. Watson and Crick were darned near amateurs when they started (relative to some of the people around). - Michael Nielsen
Harry Collins questions the whole notion of defining Science, given the range of fields and methods - Chad Orzel
He is making a subtle distinction that I don't quite get about contribution versus involvement and ideas or concepts versus claims - I'm not sure its a real distinction - Cameron Neylon
And what about all the people who do nobel prize work before they get their phd? - Jen Dodd
Pushes necessity of accreditation (PhD) and reputation. Some questions ensue from audience. - carolh
Arguably galazxy zoo etc work because they are well framed to enable contribution but the contributors don't get to make claims - Cameron Neylon
LS" Reputation is essential to a scientists participation in their community. Risk to reputation is a major constraint that disciplines members to be careful about their claims." That's also true in journalism. - Paul Guinnessy
Reputation as necessary to science. - Jen Dodd
"We agree to disagree about the reputation of those whose claims have not so far become part of consensus." That's a little too diplomatic-- plenty of people develop negative reputations. See, for example, Collins's examples re: Weber. - Chad Orzel
Risk to reputation is a major constraint on behaviour - seems to be saying this is a positive thing. Again not sure I agree - what about the right to get things wrong - Cameron Neylon
"Anonymous contributions and criticisms have no place in a scientific community." - Michael Nielsen
Anonymous contributions have no place in scientific community. That's a pretty bold claim... - Chad Orzel
LS: "anonymous contributions and criticisms have no place in a scientific community" Doesn't explain peer review (apart from the publisher knowing who said what) - Paul Guinnessy
Which is one criticism lobbed at wikis as a form of scientific communication - Bonnie Swoger
Or is there a distinction between the value of failure and bad behaviour - again I think he is assuming an understanding of subtle distinctions that are not entirely clear to me - Cameron Neylon
There's a nice example from Bill Gasarch (Lance Fortnow's blog) - an anonymous contribution of a proof on the blog. Not that I think anonmity is good. (It's bad). Just testing. - Michael Nielsen
"Premature concensus is bad for science" - I can agree with that! - Cameron Neylon
Bonnie - wikis aren't necessarily anonymous. - Michael Nielsen
"Where there are competing research programmes, resources should be distrubuted so as to encourage the weaker and increase competition" - there must be some balance here though - some optimum amount of competition - Cameron Neylon
Michael - very, very true. But that is one of the big concerns I always hear from folks when talking about the utility of wikis (and blogs) in scientific communication. "Who's to prevent someone from putting down a fake name" - Bonnie Swoger
Funding should preferentially go to young scientists, rather than giving money to senior people to hire assistants. - Chad Orzel
Funding should go to those who do the work - well possibly but that can only work where the science can be divided up into person sized chunks - that is a non-starter in modern biology - Cameron Neylon
Paul - Lee has an answer to the peer review issue - which I can't remember right at the moment - Cameron Neylon
Bonnie - there are lots of authentication systems online. Amazon and PayPal do it, piggybacking the credit card structure. Amazon even has a system that can be easily integrated with other sites; it could be easily integrated with a wiki. - Michael Nielsen
Speculation about cultural reasons for differences in number of leading scientists. I'm not sure about the examples given. - Chad Orzel
Anonimity is indeed a _big_ problem. - carolh
Paul, Cameron: There are communities where peer review is not necessarily anonymous. I think one of my astronomer colleagues has said that most referee reports in her field are signed. - Chad Orzel
Michael - interesting idea - I now have some possible answers to the objections I hear. - Bonnie Swoger
Pico Iyer, "Global Souls": Gaaah! I hated that book. - Chad Orzel
I can relate to that last one point... - Cameron Neylon
scientists have been global souls for decades. - Paul Guinnessy
I've had the argument with Lee around anonymity and psuedonymity - he has a point around the nature of the decision that argues for some things it is acceptable (not good - but acceptable) - but I'll get teh details wrong - Cameron Neylon
Lee: given that universities emerged from monasteries, that evolved to preserve old knoweldge, are universities the best places to develop new knowledge? - Jen Dodd
As a result, the share of all S&E doctorate holders employed in academia dropped from about 55% to 45% during the 1973–2006 http://www.nsf.gov/statist... I would argue that universities may be the most visible part of the science community, but a significant amount of science is done outside of universities (or used to). - Paul Guinnessy
Issues with how science works: concentration of power in older scientists versus concentration of ideas in younger scientists. - Jen Dodd
Love the hockey stick pointer... - Michael Nielsen
Shows graph indicating that percentage of faculty over 50 has doubled since 1969. - Jen Dodd
NY Times article with the graphic about age distribution: http://www.nytimes.com/2008... - Bonnie Swoger
what I love about the hockey stick is the sign taped to it saying not to remove it from the lecture theatre :-) - Cameron Neylon
Age of principle investigators has gone up a lot - eg, 1/3 under 40 in 1991 versus 1/6 in 2006. - Jen Dodd
the interest in new approaches is driven by the loss of opportunities for young scientsits as they move into the academy - get no argument from me on that one - Cameron Neylon
LS "its a very different world for a young scientist today than it was in 1980." 86% success rate applying for NIH grant compated to 23% odd today - Paul Guinnessy
I wonder how field-specific the risk aversion is. I've been fairly impressed by the number of young faculty in my field who are doing really novel stuff. - Chad Orzel
I don't think high-risk / high-payoff is the issue. It's a question of giving up central control. - Michael Nielsen
Obama quote from ScienceDebate2008 site: http://www.sciencedebate2008.com/www... - Chad Orzel
THere is a tension between this notion of supporting young faculty to do high risk research and the effect this will have on their reputations - how does the community judge this kind of research? I've certainly fallen on the wrong side of that divide at least once. - Cameron Neylon
Changing topic: how have Science 2.0 initiatives helped the situation? - Jen Dodd
Funding for junior faculty - I would guess this has implications for whether new PhD's are staying in science or staying in academia. - Bonnie Swoger
Lots of different ways to do with broadening access - to young people, to people in developing countries, etc (although there is a lack of data). - Jen Dodd
still get pissed off that science = academia (either that or something got lost in translation) - Deepak Singh
I wonder if there is an assumption here that science is treated the same globally? e.g. scientists are seen more like teachers in some countries such as Iran, and critical thinking isn't emphasized, which forms the basis of "western"-type science. - Paul Guinnessy
Lee: Will also help with collaboration in the coming era of higher cost air travel. - Jen Dodd
How might Science 2.0 initiatives hurt science? - Jen Dodd
Concerned about anonymity... so get rid of it. Lots of online sites have. - Michael Nielsen
It seems like anonymity is a short-term problem. - Jen Dodd
Re: blog comments, Teresa Nielsen Hayden has observed that you can either have anonymous comments or unmoderated discussions, but not both. - Chad Orzel
Back to how Science 2.0 helps. - Jen Dodd
Or we simply impose authorship - which has been very successful at OpenWetWare with no history of any vandalism or idiocy in four years - Cameron Neylon
Various ideas on virtual reality, exploration, etc. - Jen Dodd
the idea of a ful record of your lifes work - and being able to parse it through some sort of visual interface - Cameron Neylon
It seems like Lee is mostly interested in Science 2.0 tools that are about enabling the individual to learn, remember and explore, rather than enabling different styles of interaction with other people. - Jen Dodd
"Social networks are fine, but many of the people I'd really like to talk with are dead." - Jen Dodd
"Is there a scientific analogue of the Clock of the Long Now?" - Michael Nielsen
I get the impression Lee hasn't thought about the role of social networks in e.g. providing that list of the best review articles for him - it won't be a computer - it will be the social network that finds that review for him in my view - Cameron Neylon
But I love the idea of expanding the horizon backwards into history - enabling the immediacy of the past - if the past is a foreign country it might be fun to visit - Cameron Neylon
Cameron - I think the world is sharply divided between people who've used crowdsourcing, and those who haven't. - Michael Nielsen
I think we are beginning the process of extending the horizon with a wide variety of digitization projects. Proceedings of the Royal society are available on JSTOR back to 1665, for example. - Bonnie Swoger
Great talk, well worth watching. - Michael Nielsen
Michael: There are two types of people in the world...? - Cameron Neylon
Agreed - well worth watching - Cameron Neylon
I agree. - Jen Dodd
Race/gender question: Very important issues, large disparities troubling, but the picture laid out here is aspirational, not necessarily descriptive. These are principles of science, but they're not necessarily applied as well or universally as we would like. - Chad Orzel
Since I'm the one who asked about race and gender, I should note that I agree with what Lee says here; I just thought it was a significant omission from the picture, and needed to be mentioned. - Chad Orzel
I second that Chad. (e.g. that its aspirational, not necessarily descriptive) - Paul Guinnessy
Question: "Jane Smith" has harder time getting published than "John Smith"-- can anonymity help? - Chad Orzel
Answer: Name is important, but it doesn't need to be real name. Consistency is what matters-- always use same pseudonym. - Chad Orzel
Absolutely - as a description of aspirations for a community I think they are great - some of the argument turns on the extent to which we should take them seriously as a representation of reality at the moment - Cameron Neylon
"There's virtually no selection in Britain, anybody walks in and gets tenure"-- Harry Collins. Cameron, any comment? - Chad Orzel
its not as clear cut as that, but you can get tenure without a PhD if you're publishing record is strong - Paul Guinnessy
Paul Ginsparg: Harvard was not a nasty place, you would realize that with experience you were too thin skinned - Paul Guinnessy
Chad Orzel
Quantum Physics for Dogs Preview - http://scienceblogs.com/princip...
I keep getting sideways looks when I mention my book, so here's a quick preview of what it's like. This file probably won't be kept up forever, so look quickly if you'd like to see it. - Chad Orzel
It's a deliberate Pratchett reference, actually. I love his stuff. - Chad Orzel
Quantum, Pratchett ... now that's always worth a look see - Deepak Singh
Chad Orzel
Harry Collins: Does electronic communication make any difference to the nature of expertise?
Sociologist, looking at the nature of expertise and decision-making in science - Chad Orzel
Paper mentioned in talk: Collins H M and Evans R J - The Third Wave of Science Studies: Studies of Expertise and Experience, Social Studies of Science 32 2 (2002) 235-296 - Chad Orzel
Different types of tacit knowledge. To what extent can one understand things without social interaction? - Michael Nielsen
Observation: Harry is making very precise distinctions. This is hard to micro-blog. - Michael Nielsen
Periodic table of knowledge: Level 1 ubiquitous (language, interaction), Level 2 : Different types of specialist expertise from the very basic (can be written on beer mat) to need to interact in detail with specialist community, Level 3: Meta expertise, used to judge or discriminate between experts, ranging from ubiquitous, local, technical connosseurship (criticise but not do), and referred experitse (next slide). Level 4 ; meta critera, credentials, experience, track record - Cameron Neylon
Book mentioned: "Rethinking Expertise" http://www.worldcat.org/oclc... - Bonnie Swoger
@Michael Yes: Was that a reflective observation based on your experience or your track record? - Cameron Neylon
Going to focus on interactional expertise. - Michael Nielsen
interactional expertise: gained by interacting with experts e.g hanging around physicists for 20 years - Cameron Neylon
@Cameron: AN unreflective observation based on ignorance, more like it. - Michael Nielsen
not just learning to 'talk the talk' but to 'walk the talk' - Cameron Neylon
Key question: Can you gain expertise without having domain abilities? - Cameron Neylon
Interaction game: Turing test for someone with interactional expertise only, pretending to be a full-blown expert. - Michael Nielsen
This is basically the turing test isn't it? - Cameron Neylon
There's a link to a couple of chapter of his book as a word document; the table of expertise is on page two: http://www.cf.ac.uk/socsi... - Jen Dodd
Distinction from Sokal: Collins says he actually has expertise, while Sokal does not. - Michael Nielsen
He gives an example of a question where it's hard to tell his answer from a gravitational waves expert's answer - and in fact the audience mostly guesses wrong. - Jen Dodd
He comments how nerve-wracking it was to be trying to answer the questions. Reminds me of what it's like to be a grad student. :) - Jen Dodd
Not really clear to me how this is all that different than some experimental group leaders, who don't know the math all that well (or at all), and their own students wouldn't trust them in the lab :-) (Not all experimentalists are like this, of course!!) - Michael Nielsen
Blind versus sighted Turing test: blind people can judge it 100%, but others do no better than chance. - Michael Nielsen
I think his point is that at core he can't 'do' physics but can talk it - how much of this is just a self view I can't really tell - Cameron Neylon
Cameron: my point is that there are physicists like this. - Michael Nielsen
So there seems to be a difference between how "experts" judge others' expertise and how "lay people" judge expertise on a given topic. - Bonnie Swoger
Michael - not just physicists :-) - Cameron Neylon
Michael: I think the key question is whether it's a matter of details or acquired skills. I know a lot of people who are groups leaders whose students wouldn't trust them in the lab, but it's because they don't have the fiddly knowledge of details of the apparatus. - Chad Orzel
This is fascinating but impossible to live blog - anyone out there just watch the video! - Cameron Neylon
This reminds me a LOT of how programmers talk about project managers. - Michael Nielsen
The difference between people whose students don't trust them in the lab and Collins is that while, say, Bill Phillips might not know enough about a particular experiment to run it these days, he has the background he needs to be able to do so, if he had a crash course in what all the knobs do. - Chad Orzel
It reminds me a lot about advice on how to project manage in general - phases of gaining respect as opposed to expertise - which I think map onto contributory versus interactional expertise - Cameron Neylon
"Trading Zones and Interactional Expertise" - Harry Collins, RObert Evans, Mike Gorman - Michael Nielsen
I wonder if it's understood what sorts of expertise travel well between fields, and what sorts don't. - Jen Dodd
Claim: physics is an oral culture. - Jen Dodd
He's wrong. It's a conversational culture. Big distinction. - Michael Nielsen
What's the difference? - Jen Dodd
You can have conversation without oral discourse. E.g., what we're currently doing. - Michael Nielsen
Jack Sarfatti on Wikipedia: http://en.wikipedia.org/wiki... - Chad Orzel
main claim seems to be that internal communication via conversation/oral tradition is entirely different to the outside view looking in - Cameron Neylon
Jack Sarfatti sends Physics Today roughly 3-5 emails every day. Its so bad I've set up a rule to automatically delete his emails. - Paul Guinnessy
example of T-lasers - surely this is a failure of the abstraction involved in circuit diagrams - video or pictures would have solved the problem? - Cameron Neylon
"Oral culture" (=transmission of knowledge orally) versus "orality" - see http://en.wikipedia.org/wiki... - Jen Dodd
Cameron - Things like JoVE are pretty explicitly to transmit formerly tacit knowledge. - Michael Nielsen
we can always do better but we can never win - Cameron Neylon
labs have secrets. It was only after visiting one lab I realize they were deleting so much of their data, that if you put it back it their data had a 82% percentage of error, compared to the 1-5% their results suggested. - Paul Guinnessy
FInal part: what difference does the internet make? - Michael Nielsen
I think the TEA laser thing is an example of the mismatch effect he was talking about-- the need for wires to be short was something that the original builders didn't realize needed to be transmitted. Had they been aware of the problem, they would've said, or included a picture, but they just slapped it together in some way, and it never occurred to them that people needed to be told. - Chad Orzel
Three types of tacit knowledge: contingent, somatic, and collective tacit knowledge. - Michael Nielsen
Harry Collins and Robert Evans book: "Rethinking Expertise" - Michael Nielsen
Claim: can only get "collective tacit knowledge" (eg, how to ride a bike in traffic, which differs from country to country) by immersing oneself in the relevant culture. I don't think I agree with this. - Jen Dodd
Web page mentioned on final slide: http://www.cardiff.ac.uk/experti... - Chad Orzel
very unlikely that different fields of physics can improve commuication between them. I disagree with some parts of that, as SI units is an example where there is some basic commonality between scientists - Paul Guinnessy
"Interactional expertise" is parasitic-- only those with contributory expertise can transmit it. - Chad Orzel
Sort of like a disease.... - Jen Dodd
Wiki-looking list of definitions of concepts: http://www.cardiff.ac.uk/socsi... - Chad Orzel
Is the argument that any common language necessarily abstracts from 'reality' therefore creating a body of tacit knowledge - Cameron Neylon
"Interdisciplinarity is worse than learning a foreign language because all the damn words are the same, but they mean different things in different communities." - Chad Orzel
Collins: Interdisciplinary expertise is different to multidisciplinary relationships in which an experiment is tacked on to a larger project, (i.e. understanding of the other field is not required for the project to be an success.) - Paul Guinnessy
That was really interesting, if impossible to microblog :) - Jen Dodd
Chad Orzel
Micro-Blogging Conference Talks - http://scienceblogs.com/princip...
A blog post about what's going on back here. - Chad Orzel
Now that the circle of meta-reference is completed, the entire Web 2.0 infrastructure can disappear into its own navel... - Chad Orzel
@Chad hey it's CERN's job to create black holes, not FriendFeed's - Richard Akerman
I just bookmarked it on del.icio.us. So people can comment on the corresponding item in my friendfeed, from del.icio.us, of your post, about this room. Aargh. - Michael Nielsen
Cameron Neylon
Panel Session - The Future of Scientific Collaboration
Simeon Warner, Timo Hannay, Michael Nielsen, chaired by John Dupuis - Cameron Neylon
What are people's backgrounds, Simeon experience with Arxiv, Timo background in tools development communication -> collaboration, Michael's just here to make trouble - Cameron Neylon
Question: What is missing in scientific collaboration? - Cameron Neylon
@Cameron: :-) - Jen Dodd
Michael - can't get access to the expertise - Cameron Neylon
issues of trust if you don't know people - how do you find the right person - Cameron Neylon
John: "presumably we want to make scientific collaboration better" - Jen Dodd
simeon - open access enables collaboration by enabling the building to tools across different disciplines - Cameron Neylon
Problem: Finding the expertise you need - Chad Orzel
Timo - enabling collaboration helps by enabling communication across disciplines - encouraging mutual understanding [by providing shared spaces?] - Cameron Neylon
do we get better mutual understanding by talking behind the speakers back? - Cameron Neylon
Timo - some disciplines qualitatively changing - industrialisation of biology - Cameron Neylon
Simeon: shift from small group tight collaboration to larger more diffuse collaborations will be enabled by better search tools. - Jen Dodd
John: Are collaborations going to get bigger and bigger? - Jen Dodd
Timo: numbers of authors are getting larger and larger - there's very few single-author papers anymore. - Jen Dodd
Michael: But are the ties between the collaborators getting weaker and weaker? - Jen Dodd
Michael: Eg: crowdsourcing of research. - Jen Dodd
What about the cultural question. Loose, informal collaborations between like-minded people - Deepak Singh
Cameron: the big science people can bring in the communications people, the IT, the infrastructure and so forth. The question is whether I can do big science with small pieces -- I'm starting to see it's possible in small ways. - Mark Tovey
@Deepak - what do you mean? I can ask your question if you'd like.... - Jen Dodd
I think deepak is interested int he social issues involved in loose collaborations that come together rapidly to solve a very specific problem? I think Harry Collins would have an interesting perspective on that. - Cameron Neylon
Not sure what the exact question would be though? - Cameron Neylon
No, me either. - Jen Dodd
Q: What's different in the incentive structure... that motivates people to sit on a result until it's big enough. vs something like Linux where people contribute small pieces. - Mark Tovey
John: there was an example yesterday - birders, or galaxy zoo - people can contribute one line of science - Mark Tovey
Can you get credit for one line of science - Paul Ginsparg mentions that many Wikipedia articles clearly have academic contributions - Cameron Neylon
Michael: the math blogosphere is an interesting example -- very serious mathematical conversations are going on on mathematics blogs - and it's a paragraph, and not a paper -- a famous mathematician will add their two extremely insightful paragraphs. - Mark Tovey
Michael: Should we change the way we hire academics? Yes. - Jen Dodd
Harry Collins: I don't write books for direct rewards. - Jen Dodd
Michael: But the writing of books is subsidised by society - academics have jobs. - Jen Dodd
Michael: until we started subsidizing publishing, there was no incentive to publish. - Mark Tovey
Lee Smolin: Collaboration is primarily through small-scale informal interactions - conversations, questions, etc. - Jen Dodd
Lee Smolin - we make contributions through many small things, papers have a different function, reputation can be gained by having name on a relatively small number of papers with a big impact - Cameron Neylon
Lee Smolin: The way to make a career as a theoretical scientist is to write 6-12 single-author papers that have had a significant impact. - Jen Dodd
Lee Smolin: I don't see how these new tools help with doing that. - Jen Dodd
Paul Guinnessy - major different of future collaboration will be speed - Cameron Neylon
Alex Pang: book about "Why people want to do things well" - addressing the question of why people do things better than economics predicts they will. - Jen Dodd
we seemed to be getting bogged down on rewards rather than collaboration - Cameron Neylon
I agree - Jen Dodd
Book mentioned by Alex: http://www.amazon.ca/Craftsm... - Chad Orzel
I suppose yesterday we got bogged down in data sharing rather than communicating with the public... - Cameron Neylon
as long as we cover everything in the end... - Cameron Neylon
concern that overmeasuring credit could be oppressive - Cameron Neylon
or maybe we're moving on to outreach now? Collaboration with the public as outreach? - Cameron Neylon
Discussion about ivory tower issues - can you be a successful scientist by only publishing papers for an extremely narrow audience? - Jen Dodd
Shifting topic to interdisciplinary collaboration. - Jen Dodd
Timo: Neuroscience is already very interdisciplinary, and they already find it very difficult to talk to each other. - Jen Dodd
Timo: Science Foo Camp is the project I've been involved in that has done the most for interdisciplinarity. - Jen Dodd
Timo: We don't always need new tools or code to change collaboration. - Jen Dodd
Michael: An example of a collaboration emering from SciFoo. Robin Hanson complaining about how people aren't publicly committing to what will emerge from the LHC. He wanted a betting market on outcomes. Michael put him in touch with an outreach person interested in setting up a collaboration market. - Jen Dodd
John: Do you have any experience doing interdisciplinary research? - Jen Dodd
Michael: Yes - it's very difficult at first because of language issues. Physical proximity is valuable for getting through this phase. - Jen Dodd
I was going to say something about the need for translators but I htink Michael kind of covered that point - Cameron Neylon
John: Interesting experience collaborating with someone from humanities. Debate on the title of the article - humanities wants a title with a colon. - Jen Dodd
I often write titles with colons in - does that make me a sociologist? - Cameron Neylon
Timo: Interdisciplinary institutes. In systems biology, physicists have had a disproportionate influence because of the power of interdisciplinary collaboration. - Jen Dodd
Chad Orzel: What sorts of technology could help with interdisciplinary research? - Jen Dodd
usefulness of tools for helping the comprehension between different fields - see John Willinsky's talk yesterday - Cameron Neylon
Timo: Interested in automating finding papers of interest outside your discipline. - Jen Dodd
Eva: University of Toronto did a study about the barriers to interdisciplinary fields. Major finding: people couldn't explain their work to their own departments. - Jen Dodd
jen asked what mighht have been deepaks question. What tools are needed for croudsourcing groups for bursty science - Cameron Neylon
One answer: realclimate.org (from Paul Guinnessy). - Jen Dodd
pretty vague answers but Paul mentioned http://realclimate.org which will deal with answering unscientific claims about climate change - Cameron Neylon
Lee Smolin: most difficult issue is capturing people's attention because academics have extremely limited attention. - Jen Dodd
Simeon: a common problem is that a problem you solve in someone else's community isn't considered an interesting problem in your own field. - Jen Dodd
Lee Smolin: If you solve a problem using a technique from your community that the target community doesn't understand, it likely won't get picked up because they won't be motivated to put the effort into learning the background required to understand it. - Jen Dodd
Or is that because people don't build tools that offer a compelling use case to the target community - Cameron Neylon
Change of topic: what are the barriers to collaboration, and what sorts of incentives could we use to overcome them in the future? - Jen Dodd
Michael: the existence of SPIRES database that counts citations to preprints at arxiv.org has changed publication patterns in high energy physics. - Jen Dodd
Simeon: Generally, citability is very important. - Jen Dodd
I'm surprised how focused this discussion has been on academia considering how much research is done in industry (I will be trying to say this point later) - Paul Guinnessy
Timo: re disincentives, interdisciplinary research is by its nature higher risk, partially because career tracks in academia run along standard paths. The potential rewards are higher, but scientists are often risk-adverse. - Jen Dodd
Paul - good point, and arguably industrial research is inherently more interdisciplinary - Cameron Neylon
@Paul - I agree - Jen Dodd
Question: Should interdisciplinary research be discouraged? - Chad Orzel
Cameron Neylon: Describes a top-down approach to interdisciplinary research by funding projects (100 million pounds for various five year projects), with mixed results. - Jen Dodd
Michael: Paraphrasing Eric Weinstein, the normal sorts of communities don't exist around interdisciplinary research, so you end up supporting low-quality research. - Jen Dodd
see also EU framework program, although it was successful in improving the quality of research in some countries such as Greece and Portugal (to get the money the UK, France & Germany had to work with a smaller, poorer EU country on a collaborative project). Probably not so good for the richer countries (except it was a new source of research funds) - Paul Guinnessy
Sabine Hossenfelder: Is interdisciplinarity good or is it shallow? In practice it is not usually supported very efficiently. There is occasionally funding support, but the career path is still a big problem. - Jen Dodd
yep EU is a good example of a program where the explicit aim was to uplift research in poorer countries rather than to do research per se - Cameron Neylon
Cameron Neylon
Andrew Odlyzko - The evolution of scholarly communication and the supreme power of inertia - http://www.science21stcentury.org/abstrac...
Writing a book comparing the current internet mania with the introduction of rail. - Michael Nielsen
Uncertainty of predicting impact of new technologies - Cameron Neylon
and now two of us have :-) - Cameron Neylon
40,000 people die of car accidents - Mark Tovey
how to put the human element on the uncertain future based on technology - Paul Guinnessy
2% of US GDP on net, 8% of British GDP on rail at height! - Michael Nielsen
8% of GDP in the UK spent on railways in the early 19th century - Paul Guinnessy
Analogy: "railway speed" and "internet time"! Legislating at railway speed, etc... - Michael Nielsen
fatal mistake was the assumption that things were happening on internet time - Mark Tovey
Big mistake: We assume things are changing at Internet time. - Sol Lederman
we see graph of mathematicians' rate of collaboration - carolh
Showing graph of collaboration amongst mathematicians growing - on a 50 year timescale we get 2-author papers going from 5% to 35%. - Michael Nielsen
Graph: Rapid drop of single-author math papersfrom ~90% in 1940 to <50% by 2000 - Chad Orzel
Papers reviewed by Math Reviews, which started in 1940 - Mark Tovey
I wonder how the number of papers have changed over the same span. - Chad Orzel
He wondered why collaborative work didn't start earlier... - Mark Tovey
all of these changes in maths occuring well before the internet - Cameron Neylon
Is the absolute number of single-author papers lower, or have they just added collaborative papers? - Chad Orzel
good point about total numbers - would be interesting to see the comparitive graph - Cameron Neylon
social changes take a lot of time seems to be the main point - two generations - Cameron Neylon
Credit Licklider as Internet's grandfather. - carolh
J C R Licklidder: 1964 book, "Libraries of the Future": digital libraries by 2000. - Michael Nielsen
1964: Digital libraries practical around 2000-- good call. - Chad Orzel
Overestimate what can be done in 1-2 years, underestimate what can be done in 5-10 years. - Chad Orzel
Reminds me of Danny Hillis' great quote - problems which seem impossible on 2-5 years can be trivial on 50-year timescale. - Michael Nielsen
US has made several attempts to introduce dollar coins - they've all failed. - Mark Tovey
Compares voluntary vs involuntary adoption (dollar coins adopted in Canada, not in US). - Michael Nielsen
If people don't want to come to the ballpark, there's little we can do to stop them -- Yogi Berra - Mark Tovey
Jack Licklider used the term "Intergalactic Computer Network" to talk about an idea similar to the internet in 1963, according to wikipedia: http://en.wikipedia.org/wiki... - Jen Dodd
Odlyzko in the 1990s: predicted little change over 10 years, but huge change over 20 years. - Michael Nielsen
Could we perhaps compare the change in scholarly communication that is now occurring to other slow paradigm shifts in science (the acceptance of Plate Tectonics took a generation)? - Bonnie Swoger
The inventors of new technologies often do not realize what society will find attractive. - Mark Tovey
The quote "The goals of the advertising business model do not always correspond to providing quality search to users. ... we expect that advertising funded search engines will be inherently biased towards the advertisers and away from the needs of the consumers. ... But we believe the issue of advertising causes enough mixed incentives that it is crucial to have a competitive search engine that is transparent...." I didn't catch the date. - Jen Dodd
Odlyzko's web page, with information about railroad mania: http://www.dtc.umn.edu/~odlyzk... - Chad Orzel
Not an itch - a searing pain: The price of coal would double within 10 miles of the mouth of the mine. - Mark Tovey
Page and Brin quote was 1998 according to Andrew - Cameron Neylon
railiways built to transport coal - not passengers - Cameron Neylon
Not sure I believe his claims about rail being passenger-driven eventually. The margins today on freight are far higher than for passengers - passenger rail is dead, but freight lives on. I know a lot has changed, but still... - Michael Nielsen
passenger rail in the UK is very big business - infrastructure is saturated and they still don't seem to be able to make money on it - but its growing rapidly - Cameron Neylon
Passenger rail in the UK was massively subsidized for most of the 20th century, I believe. Don't know what the situation is today. - Michael Nielsen
Freight is a major constraint on the available infrastructure, though. At least, it's one of the factors that keeps passenger rail in the US dreadful. - Chad Orzel
Parliament allowed eminent domain to be used to seize land from aristocrats. Parallels to similar tug-of-war going on between entrenched interests and new powers today. - Michael Nielsen
Railways: 2,000 miles in 1845, 7,000 by 1855, 22,000 by 1900 - Chad Orzel
Cartoon satirising ambitious plans for rail development, which later became a pretty good representation of the actual outcome: http://www.cartoonstock.com/lowres... - Jen Dodd
UK passenger travel still massivel subsidised but I also pay over £5k for a season ticket onthe most saturated line in the UK - Cameron Neylon
Harry: talked about paper saying that the optimal size of a research group is about half a dozen. - Mark Tovey
Recording (video and slides) is at http://pirsa.org/08090032/ - Jen Dodd
Cathy
Science in the 21st Century - http://www.webgoddesscathy.com/blog...
Thought you might be interested in my blog post on my personal blog... Will likely be writing something for the MaRS Blog (blog.marsdd.com) as well. Welcome ideas/comments for that post. Thanks! - Cathy
Michael Nielsen
An advantage of microblogging in this way
It occurs to me I'll be able to Google my notes at a later date, and get the benefit of everyone else's notes as well. Given that I often lose my notes, that'll be quite an advantage. - Michael Nielsen
I'm hoping that this will help my notes maintain relevancy for a longer time, too, rather than just disappearing into my filing system. - Jen Dodd
It's a little surreal to be doing this, but I think it'll be useful down the road. I wasn't sure about this FriendFeed thing, but I think I'm starting to see the point... - Chad Orzel
be aware that FF is not actually Google indexed unless it is bookmarked into a static page - Cameron Neylon
I suspect that having all the URLs in one place is going to be useful - I'll remember "Wasn't Jacques Distler talking about some wiki project... what was the name", and be able to find it. - Michael Nielsen
Cameron - I get FF hits in Google all the time. - Michael Nielsen
I get them occasionally. - Jen Dodd
I'm pretty sure arbitrary items aren't necessarily indexed unless google happens to find a 'real' page which someone has created - i.e. there has to be a link to the specific item when google spiders - Cameron Neylon
so bookmarking the room should in principle do it... - Cameron Neylon
I just bookmarked it on delicious, so we'll see. - Michael Nielsen
@MichaelNeilsen the main reason I started my work blog was so that I could google my conference notes - I might have used microblogging but it hadn't been invented yet - Richard Akerman
Cameron Neylon
Timo Hannay - The future is a foreign country: Science publishing in the 21st century
An englishman with a polish father a scottish mother, a japanese wife and a finnish first name - Cameron Neylon
"The past is a foreign country: they do things differently there." - LP Hartley - Michael Nielsen
William Gibson's great quote: "The future is here. It's just not evenly distributed yet." - Michael Nielsen
A personal anecdote coming up - a journey to japan - Cameron Neylon
Talking about change, and how people respond to change. - Michael Nielsen
He's a "digital migrant" - Michael Nielsen
just as he is a 'digital migrant' not brought up in the digital world he was a geographical migrant - Cameron Neylon
japan was an alien place - completely different - Cameron Neylon
amazing juxtapositions of western/eastern familiar/unfamiliar old/new - Cameron Neylon
Constant shocks... microshocks, through to really big shocks; then occasionally the shock of the familiar. - Michael Nielsen
"Think twice before you go to a country where the concept of death through overwork is so common that they have reduced it to a three-syllable word." - Chad Orzel
Early visitors to China apparently thought the language was a pretense, meant to intimidate them. - Michael Nielsen
Switching topics: the internet. - Michael Nielsen
The internet is a foreign land to publishers. - Michael Nielsen
Gives the example of an essay submitted by a 13 year old girl in England; written in text messagese. - Michael Nielsen
"My smmr hols we CWOT... 0 bt baas & ^^^^... IDTS!! I wntd 2 go gm ASAP, 2C my M*s again... Now its BAU" - Michael Nielsen
strange languages (text spealk and others), new currencies, new cultural currencies, gift culture - Cameron Neylon
New cultural currencies. - Michael Nielsen
Email as mass copyright infringement. - Chad Orzel
Wonderful photo from Joi Ito: younger person reading on their phone, older person reading a book. Something unfamiliar for everyone. - Michael Nielsen
the idea that emails include the previous text when you hit reply would have been totally repugnant to lawyers - paraphrase from Cory Doctorow - Cameron Neylon
(Though, really, the copyright problem would be moot if people would learn to use a goddamn text editor...) - Chad Orzel
"How can you imagine somebody reading their phone... it's like reading your ironing board... convergence." - Michael Nielsen
'reading on a phone..you may as well tell the recording industry that people will be listening to their ironing board' - Cameron Neylon
this is just a typing race isn't it? :-) - Cameron Neylon
How should publishers respond? - Michael Nielsen
Publishers react - PRISM as an example - Cameron Neylon
PRISM! Astroturfing... - Michael Nielsen
reflected badly on publishers in a predictable manner and was very counter productive - Cameron Neylon
publishing is not a monolithic industry - Nature, Cell, and Science are really very different - Cameron Neylon
Talks about the fact that people regard publishers in a monolithic way, but they're not actually monolithic. Gives example of Science, Nature, Cell - people think about them in a similar way, but they actually behave very, very differently, and think in incredibly different ways. - Michael Nielsen
Industry is starting to embrace change - perhaps not enough but things are changing - Cameron Neylon
all industries have progressive and reactionary peeople - Cameron Neylon
While scientists have gloried in the disruptive effect that the Web is having on publishers and libraries, with many fields strongly pushing open publication models, we are much more resistant to letting it be a disruptive force in the practice of our disciplines. (Jim Hendler quote) - Jen Dodd
... including both science and publishing (following Cameron). - Michael Nielsen
NIH request manuscript deposition in PubMED: 4% compliance. - Michael Nielsen
Nature offers to do it: 30% compliance. 70% can't be bothered to say yes. - Michael Nielsen
NIH mandate: has gone up, but still not near 100%. - Michael Nielsen
Scientists can't be bothered to change. Indeed. - carolh
I think Wellcome is finding compliance around 70% level - but don't have a source for that number to hand - Cameron Neylon
New topic: What being progressive involves - Michael Nielsen
Nature mission statement: from second issue of Nature, 1869: "First, to place before the general public the grand results of Scientific Work and Scientific Discovery; and to urge the claims of Science to a more general recognition in Education and in Daily Life;" - Michael Nielsen
Mission doesn't say anything anywhere about being a journal publisher. I skipped part 2 of the mission - about disseminating science. - Michael Nielsen
First - communicate to public, _then_ aid communication between scientists - Nature mission statement - Cameron Neylon
Mission continues: And secondly, to aid Scientific men [sic] themselves.... - Jen Dodd
Showing NPG services - staritng with connotea http://www.connotea.org - Cameron Neylon
Connotea: http://www.connotea.org/ -- Del.icio.us for academics. - Chad Orzel
going on the Nature podcasts http://www.nature.com/nature... - Cameron Neylon
podcasts very successful - above Madonna on iTunes - Cameron Neylon
"Listening to an author talk about their work is very different than reading a paper..." - Michael Nielsen
ABout 1/3 of podcast listeners not scientists at all. - Michael Nielsen
the idea of podcasts was very alien a few years back NPG is now a broadcaster as well as a publisher - Cameron Neylon
My question: does Nature make or lose money off this? (I wonder if NPG is publicly traded?) - Michael Nielsen
Its all a loss leader - NPG is part of a privately held company - Cameron Neylon
Pretty happy with the meeting structure in Second Life now. First meeting "a debacle"... - Michael Nielsen
Cameron: How do you know they're losing money on all these things? - Michael Nielsen
Should say I don't know what the numbers are for nature.com itself as opposed to all of these additional services - Cameron Neylon
Precedings: http://precedings.nature.com/ (Nature version of the arxiv) - Chad Orzel
journal submisssion system is hooked to precedings - option to directly puit submitted documents into precedings on journal submission - Cameron Neylon
Wonder how precedings traffic scaling compares to the scaling in the early days of the arxiv? - Michael Nielsen
example of the wikified supplementary information for the Stein article - Cameron Neylon
Most scientific publishers have ignored databases. - Michael Nielsen
growing role of scientific databases - nature.com inforamtion gateways, working with partners with NIH funding to provide data access - Cameron Neylon
Wiki with supplementary info: http://nrgwiki.nature.com/cyberin... - Jen Dodd
Gateways and databases: http://www.nature.com/databas... - Chad Orzel
SciFoo! - Cameron Neylon
Science publisging is changing - obvious change is that it has moved online' - Cameron Neylon
but also critically about functionality - Cameron Neylon
Adding functionality, not just serving content-- becoming software companies. - Chad Orzel
"we're more and more turning into a software company" (rough) - Michael Nielsen
Not "If we build it they will come"... "Unless we build it we won't know" - Michael Nielsen
"the product is the market research" in some cases - Michael Nielsen
"If we don't ever fail, we're not trying hard enough." - Chad Orzel
"If we don't ever fail we're not trying hard enough" - Bonnie Swoger
An "experimental publisher," as opposed to a theoretical publisher. I wonder what that would be... - Chad Orzel
Hard to escape the feeling that while a lot of science publishers might die in the coming years, Nature isn't going to be one of them. - Michael Nielsen
An algorithm to determine peer reviewers: http://arxiv.org/abs... - Chad Orzel
Back to Joi Ito's photo: publishers forced to re-evaluate: what do we do? - Michael Nielsen
last year, 5 of top 10 novels in Japan were keitai novels (on mobile phones) - Chad Orzel
Back to the analogy with migrants. Emphasizes not having a sense of entitlement on the part of publishers. Humble posture. - Michael Nielsen
@eva just a small interruption in the flow, here in the government we get periodic presentations from people who have email servers that purport to control messages entirely. There's a thing called Rights Management Services for Windows that, as long as everyone uses totally controlled systems, prevents people from forwarding emails and other such ridiculous limitations. I don't know if any big organisations have actually tried to use this kind of DRM for email, but the tech is there. - Richard Akerman
"We're not in Kansas any more, but that's good, because it was a pretty boring place before." - Chad Orzel
About 30 people in web publishing; gradually becoming more integrated with the rest of the company. - Michael Nielsen
We're into questions. - Michael Nielsen
30 people in Nature web publishing; 750 in NPG, MacMillan 10 times larger. - Michael Nielsen
Classified ads very online-centric, display ads largely print-centric - Chad Orzel
This was a great talk! Definitely recommend watching. - Jen Dodd
Looking at nature.com, most of the adds are for other NPG publications or products. - Bonnie Swoger
Recording (video and slides) is at http://pirsa.org/08090030/ - Jen Dodd
Michael Nielsen
Panel: "The Fall of the Ivory Tower": Cameron Neylon, Chad Orzel, John Willinsky, moderator Eva Amsen
Birdwatching is an example of citizen science - Jen Dodd
Science Film Festival coming up in New York in a few weeks - Jen Dodd
Chad's blog: "The world would be a better place if scientific data were reported in the Lifestyle section of the New York Times".. - Michael Nielsen
Chad: it would be better if the lifestyle section took a more scientific approach to its reporting - Jen Dodd
Sundance Bilson-Thompson: "You want a Lifestyle Section run by the Mythbusters" - Michael Nielsen
Chad: "Yes - there would be more explosions!" - Jen Dodd
Chad: Reporter testing the foot pads that are supposed to remove heavy metals. - Jen Dodd
John: Business section articles often have embedded urls to research. - Jen Dodd
Cameron talking about the Science Blogging Conference. - Michael Nielsen
Debunking bad science: http://badscience.net/ - Michael Nielsen
Science Blogging Conference: http://www.nature.com/naturec... - Jen Dodd
Cameron: phrase bandied about at the conference: "not only are we geeks, we're geeks in an echo chamber" - Jen Dodd
The Science Blogging Challenge: http://blogs.nature.com/wp... - Jen Dodd
Discussion about making research data or methods available. - Jen Dodd
Census data as an example. - Michael Nielsen
Jonathan Walgate: the value of publishing data for negative results, especially in medical studies - Jen Dodd
http://www.patientslikeme.com/ as an example of public knowledge. - Michael Nielsen
Chad: physics needs The Journal of Failed Experiments or The Journal of "I thought that would work" - Jen Dodd
Cameron: journal of failed experiments is a good way of communicating to the public what science is actually like. - Michael Nielsen
Chad: addicted to the feedback (comments) on his blog posts - Jen Dodd
Chad: many more comments (10-100 times as many) on "fluff" posts than on "science" posts. - Jen Dodd
Chad: but it may be that the science posts last better - that they ultimately get a similar number of views as the fluff posts. - Jen Dodd
Chad: a blog poll: "is e or pi your favorite irrational number?" got over 100 coments. - Jen Dodd
Eva: most popular blog post is her post about why bread isn't glue, since both are made of flour and water. - Jen Dodd
Cameron: it turns out that how much of an organic compound you can put in a solvent is not well known. Idea for "chemistry at home". - Jen Dodd
John: open source data crunching - Jen Dodd
define open source data crunching - Deepak Singh
Like open source software development: people incrementally do pieces of the analysis on raw data, share it with each other, analyze other people's contributions, and so forth. - Jen Dodd
... I assume that's what John had in mind - it was an off-hand comment that I found interesting. - Jen Dodd
Eva: what fields are easier to get the public involved in? - Jen Dodd
Michael Nielsen: galaxy zoo http://www.galaxyzoo.org/ is getting the public involved in basic physics. - Jen Dodd
Ecological data as another example. - Jen Dodd
Cameron: weather data too - Jen Dodd
Cameron: DIY bio is a group of people who try to make low-tech home versions of, for example, genotyping set-ups. - Jen Dodd
Eva: chemistry sets are being reduced to containing almost nothing. - Jen Dodd
Discussion of open textbooks. - Jen Dodd
Cameron: is there a problem with this idea since scientists currently get little reward (other than monetary) for writing textbooks? - Jen Dodd
TED talk on "Open Textbooks": http://www.ted.com/index... - Victor / Mendeley Team
Site licenses are available to textbooks for libraries. - Jen Dodd
Here is the link to the online textbook whose name I couldn't recall "something with mountain" http://www.motionmountain.net/ - Sabine Hossenfelder
Other ways to read this feed:Feed readerFacebook