 |
|
| FriendFeed is the easiest way to share online. Learn more » |
Roland Krause › Comments
Entspann Dich! - SIXTUS.CC - http://sixtus.cc/entspan...
Gott.
- Roland Krause
Santa's a Health Menace? Media Everywhere Are Falling for It—But the Study Was Meant as a Joke - NurtureShock Blog - Newsweek.com - http://blog.newsweek.com/blogs...
Neil Saunders liked this
Media competence for the media.
- Roland Krause
Thélème - http://www.theleme-lejeu.com/
Learn French using MMORPG.
- Roland Krause
Mechanisms of gold biomineralization in the bacterium Cupriavidus metallidurans — PNAS - http://www.pnas.org/content...
Aren't we all metallophiles?
- Roland Krause
Cell - Protein Sectors: Evolutionary Units of Three-Dimensional Structure - http://www.cell.com/retriev...
An interesting read for sure but is it really a deviation from how we view proteins and their structure today?
- Roland Krause
Internet-Manifest - http://www.stefan-niggemeier.de/blog...
lang:de
- Roland Krause
Genome Biology | Nation of twits - Gregory Petsko - http://genomebiology.com/2009...
Mickey Kosloff, Neil Saunders and Duncan Hull liked this
"Gregory Petsko bemoans the rise of the Twittering classes." I don't have a subscription to access, but I can imagine the content...
- Shirley Wu
from Bookmarklet
Me too :)
- Deepak Singh
its not all negative, but it bewilders me why Gregory's column is closed access, in an open access journal
- Duncan Hull
Genome Biology seems to have this odd open/closed split personality. As for Petsko, his relentless tirades against anything non-traditional used to annoy me. Recently though, I've begun to find them amusing. I think his role is to be the contrary curmudgeon, much like newspaper "opinion" columnists. That, or the ranting drunkard at the bus stop.
- Neil Saunders
It's exactly as you expect - an old miser ranting about the use of communication tools by people he is not communicating with. No need to discuss any of this in Fall of 2009. Petsko would long be silent if he had to run a blog rather than use the GB editorial for his fall out.
- Roland Krause
Come on, he is a contrarian and a cynic but he's also quite funny. I used to read his columns on a regular basis and some had me laughing out loud in the lab. I never met him but I was always under the impression he doesn't take himself or his columns too seriously. But as for Genome Biology putting the editorial column behind a subscription wall, I couldn't agree (or rather - disagree) more.
- Mickey Kosloff
The seven deadly sins of comparative analysis. [J Evol Biol. 2009] - PubMed Result - http://www.ncbi.nlm.nih.gov/pubmed...
Konrad Förstner and Michael Kuhn liked this
Includes hand-on solution to the most common problems. Très chic!
- Roland Krause
There was way more Science Online London traffic on Twitter than on FriendFeed. Bye-bye FriendFeed for conference blogging? #solo09
Duncan Hull, Richard Akerman and suelibrarian liked this
I believe it all depends on what the participants are more comfortable with. I find it incredibly difficult to follow Twitter, especially when there are parallel sessions. However, at solo09, I think there were more people who preferred Twitter to FF, which is cool. We can use both at once! :)
- Allyson Lister
while you can grab the hashtag into a FF room why does it have to be either or?
- suelibrarian
We should have set up the FF solondon group to import tweets with the hashtag #solo09. But if almost all messages are just single tweets, I might as well follow Twitter directly. Using both FriendFeed and Twitter for live-blogging, and also participating at the conference is a little bit too much for me.
- Martin Fenner
I find it strange that people prefer Twitter to Friendfeed for conferences precisely because of the threading but as Sue says, in an idea world it wouldn't matter - it could all just be pulled together. Funnily enough Maxine lead a session on re-aggregating conversation at last years conference. We're a lot further down that road now but it is very far from perfect...
- Cameron Neylon
from twhirl
I find the twitter stream of #solo09 incomprehenisble and get very little out of it. Twitter is probably the better tool for emotional participation with jokes, praise and food static, Friendfeed for collaborative coverage.
- Roland Krause
Something that unfortunately wasn't mention yesterday is Streamosphere. A perfect tool (written by Euan Adie) to aggregate coverage (blogs, FriendFeed and Twitter) of Science Online London: http://streamosphere.nature.com/preview...
- Martin Fenner
Agree that it shouldn't matter, so long as the information gets out and goes somewhere. I still think FF is a great tool for this purpose though and plenty of recent meetings have used it effectively, so this one was something of an anomaly, not a pointer.
- Neil Saunders
Evidence for an early prokaryotic endosymbiosis : Article : Nature - http://www.nature.com/nature...
Björn Brembs liked this
This is a really old-school paper, isn't it? Single author, lots of phrases such as "I find it fascinating", "I cannot help but notice", "I believe that this agreement...".
- Neil Saunders
I like old-school, man. But the statements that you singled out are not the greatest achievements of scientific prose indeed.
- Roland Krause
I found them "unusual in this day and age", but not necessarily unwelcome.
- Neil Saunders
We do not read first person voice in science these days. The phrases you mention can all be made simpler and stronger, e.g. by "<fascinating statement only>" or "Note ...!" (Imperative rules OK!) . And never say that you believe something in a paper, because otherwise you shouldn't write it in the first place.
- Roland Krause
(Ah, nitpicking on the internet, that's why I switched the VPN tunnel on")
- Roland Krause
Overheard regarding papers published in PLoS ONE - "it was rejected somewhere else", "The bar is 'not crackpot'", "people publish in CNS because that's where the attention is, I don't know anyone who reads PLoS ONE", "The reputation of the journal is a good way to filter out noise". Is there truth to these claims? Discuss.
Cesar Sanchez, 'Mummi' Thorisson, Mike Chelen and 19 other people liked this
Almost all papers, in all journals, have been rejected from somewhere else. Our bar is "is it science, is it conducted properly, is it reported properly, and do the conclusions follow the data etc" - the bar is not "is it sexy, or impactful, or a major advance". At the same time, we are not CNS - as we are not selective. CNS combined publish just 5,000 articles a year between them but...
more...
- Peter Binfield
Peter, I certainly don't disagree with what you're saying and think PLoS ONE is valuable and innovative. But I was wondering if these negative judgments are pervasive (FF/twitter is a bit of an echo chamber and the real world can be a shock sometimes) and if so how to change them. There are those who argue that CNS has high precision even if they miss some good papers and so it's more...
more...
- Shirley Wu
The problem with echo chambers is that the Internet echoes forever; and forever is a long time. We just need to push out as much positive info as possible to try to combat any negative comments which may have been made rashly, or in error, but which get re-referenced for eternity. Our article-level metrics program will presumably show people whether any given paper in PLoS ONE is 'high'...
more...
- Peter Binfield
There's this thing known as FUD. Happens when someone sees their status eroding. The whole PLoS articles are not as good is just that, FUD
- Deepak Singh
Indeed, it may be fear, uncertainty, doubt. It may also be lack of information and hard data. We are going to fix the latter. Certainly, people are voting with their feet - we have 37,000 published authors in under 3 years, and people are publishing with us in ever increasing numbers (http://poeticeconomics.blogspot.com/2009... )
- Peter Binfield
"it was rejected somewhere else" - perhaps. This is hard to tease out, but I have a feeling that most of the manuscripts that come to PLoS ONE have never been submitted elsewhere
- Bora Zivkovic
"The bar is 'not crackpot' - good bar, IMHO. Why is any other bar necessary? Think. Really.
- Bora Zivkovic
"people publish in CNS because that's where the attention is, I don't know anyone who reads PLoS ONE" - who still reads journals? Srsly? Don't people search online for papers they are interested in? Do physicists read biology papers when their copy of Nature arrives? No, they read Nature for "news and views".
- Bora Zivkovic
"The reputation of the journal is a good way to filter out noise" - perhaps a century ago when every scientist could read every scientific paper and understand it, and every scientist was a 'Victorian scholar' who felt the need to keep up with ALL of science. Today, you read papers in your narrow field - you find them online. News from other sciences you can find in pop-sci magazines, on blogs, etc.
- Bora Zivkovic
@Bora, I think there are still a fair number of people who don't search for papers necessarily, but browse TOCs, and so only browse the journals they're familiar with. During the discussion, someone asked, baffled, "but there are already so many papers [without PLoS ONE publishing so many more], how would people find ones of interest to them??"
- Shirley Wu
A related discussion - based on a correspondence in Nature by a proponent of the views Shirley cites - is at http://ff.im/4GWlM .
- Daniel Mietchen
@Shirley - although ToCs are certainly an important discovery tool, any publisher will tell you that the vast majority of their usage comes in from Google (who then read an article, and leave again to run another search)
- Peter Binfield
@Peter, that would make sense, but I'm wondering if that necessarily translates into Google being the majority of people's preferred method for finding papers. At least the impression I got from folks in my lab was "so many papers, so little time" and so they're skeptical of anything that adds to the glut of papers without clearly adding value. They might agree on the principle that...
more...
- Shirley Wu
They also think, "if [a peer reviewer] didn't make a value judgment on whether this paper is significant, why should I waste time reading it?"
- Shirley Wu
"I'm wondering if that necessarily translates into Google being the majority of people's preferred method for finding papers" - Good point. I guess you would want to measure time spent on page by people who come via the 2 (or more) routes to see how targeted their interest was
- Peter Binfield
@Shirley - Then they are admitting that they would prefer one (or perhaps 2 or 3) other people to decide what is important for them, and so decide on their behalf what they should be reading. Doesnt sound like a very informed way to filter imho...
- Peter Binfield
@Peter, more that a million people access papers through google 25% of the time will mean that publishers see google as a huge source of traffic, but doesn't mean that people think of google as their preferred method to find _NEW_ papers.
- Shirley Wu
@Peter, well, it's using expert opinion. We all use it to some extent in areas we're not familiar with. If people aren't that internet savvy or aren't that organized, they depend on other people or name-brand journals to bring things to their attention. Also, commenting on papers hasn't really taken off yet - just a matter of time, probably - but it just means that the post-peer review process hasn't really proven its value yet.
- Shirley Wu
"but it just means that the post-peer review process hasn't really proven its value yet." - indeed, and we DONT view our efforts as post-pub peer review. We view it as a new way to do post-pub evaluation / filtering / discovery.
- Peter Binfield
Oh, the other thing that someone mentioned was "comments are valuable" - meaning "why would I give away my intellectual capital?" People are willing to share their comments with their labs or close colleagues, but not to the public or to the general scientific community. Is this just another mindset we combat with positivity and action? How to combat the vicious cycle of "no comments, so no value", "no value, so i won't comment"?
- Shirley Wu
"Is this just another mindset we combat with positivity and action?" - I would say we combat it by showing them the power of being open about these things. For example, social bookmarking only works when everyone shares their bookmarks - in this example there is a clear benefit to both contribute and use. If people realised that by leaving comments they would be advancing science;...
more...
- Peter Binfield
@Daniel, ah yes, I remember that thread now. Unfortunately I think many scientists are similar in mindset to the letter writer. They don't know about or understand new ways of receiving content, which might seem strange to those of us here, but there are many more people out there than are in here.
- Shirley Wu
Also, you could use the same argument about peer review: "My time and thoughts are valuable, why should I do peer review". Apparently academia feel that the quid pro quo works in that situation at least (and that is done anonymously!)
- Peter Binfield
@Peter, true, though I think some of that is tied to the reputation of the journal again - being a reviewer for Nature > reviewer for PLoS ONE (in their eyes), editors know them, they can talk about it and gain status. They get tangible and subtle career boosts. Whereas commenting on papers online and publishing in PLoS ONE doesn't get someone tenure (yet). "It would be very brave and...
more...
- Shirley Wu
Peter - given the problems that journals have finding suitable reviewers, I would hesitate a bit calling that a working system.
- Daniel Mietchen
@Daniel :)
- Peter Binfield
Another link that may be useful reposting here: Pubfeed at http://pubfeed.cs.toronto.edu/ basically allows you to treat the whole web of scholarly articles like a TOC alert (just a bit more customizable) and pipe that into your preferred feed reader.
- Daniel Mietchen
@Shirley - please dont forget that there are 25,000 journals in the world and millions of papers published per year. CNS is just 3 titles, and if you lump together all similar titles (highly exclusive, professional editors, well known brands, conferring 'bragging rights' on anyone who works with them) then you are still talking about just a handful of the titles, with a small percentage of the content. We need a system that works for everyone, not just a small sub-set
- Peter Binfield
@Peter, oh, I'm well aware, just parlaying bits of an impromptu debate I had earlier today with people who don't see the value of venues like PLoS ONE. These are all arguments they make, and while I don't agree with them, it is tough to convince people
- Shirley Wu
You could try asking them exactly how many downloads their last paper in a 'high impact' journal got...
- Peter Binfield
Fair enough, but you know, I really don't think they think about that. They think "what will be in my CV?" and they think any journal that is somewhat competitive [includes other PLoS journals, BMC journals, etc] looks better than one that accepts anything that's methodologically sound. Again, not my view, but perhaps one that is held by many. Do people list # of downloads on their CV for publications?
- Shirley Wu
They dont, because they dont have the data. However, people do list if their paper was rated by F1000; or if BMC designated it a 'highly accessed' article. So I think they will start to say "this paper was downloaded 5000 times in the first 3 months which put it in the top x% of all PLoS ONE articles, the top y% of all PLoS articles, and the top z% of ALL articles" (when the rest of the world starts quoting this data)
- Peter Binfield
Ironic isn't it; it's not a battle with the publishers, but with other scientists! I overheard a conversation yesterday concerning choice of bioinformatics journals. It centered entirely around impact factors and at one stage someone said "I think BMC Bioinformatics is online *only*" - as though that were a bad thing.
- Neil Saunders
And it's clear that anyone who mentions "filtering noise" simply is not using the web effectively. Presumably their web use is limited to search, after which they print PDFs and go away. Concepts that seem simple to us - RSS, feed readers - are unknown to them.
- Neil Saunders
I think of it as trying to set up a social experiment. If I'm right and a more cooperative model can produce better science than the current hypercompetitive structure, then over the next decade or so, facility with new methods and metrics that center on Open practices will provide a competitive edge for some researchers, and unwillingness to change will put others at a disadvantage. We...
more...
- Bill Hooker
Good thoughts Bill. It's not enough to say "this way is better" just because we believe it to be. We have to demonstrate that it's better - or find out that it isn't.
- Neil Saunders
And isn't that the scientific way?
- Deepak Singh
from IM
"I think there are still a fair number of people who don't search for papers necessarily, but browse TOCs" Could it be that those are the people publishing in CNS and miss the most important papers for their work? http://bjoern.brembs.net/comment... It's only one example, as anecdotal as it gets, but it shows two things: 1. CNS 'quality' is merely correlational and highly noisy....
more...
- Björn Brembs
My environment is rather positive about PLoS ONE. We all know about the difference between relevance and quality. While many PLoS ONE papers might not be of widespread interest, the review process is of comparable quality or better to smaller conferences and e.g. high volume BMC journals. Other journals have severe issues with reviewer quality these days, and it seems to become worse.
- Roland Krause
I'm still wondering about the degree of scalability of post-publication (significance) peer review systems. Is it really realistic to think that once (all) journals go OA and implement such a system that the entire scientific community will benefit? Assuming that it's "fair" for all journals to get equal amount of attention from "scholarly feedback communities", how can we encourage...
more...
- Wobbler
I agree with Bill Hooker's statement just above. Those who echo Shirley's original quote will be at a disadvantage, which means better odds for the Shirley's of the research world.
- Jason Hoyt
I often say something along the lines of what Bill said. The environment is changing. To succeed in the new environment, one has to change not just one's publishing habits, but also rethink how to do research and how to write it. Thus, people who think about it early on will be able to gain advantage over people who are still stuck in the old ways of doing things. As the new environment...
more...
- Bora Zivkovic
Cell Beta Prototypes - http://beta.cell.com/
Nice but not groundshaking, more of a tech demo than a update to publishing.
- Roland Krause
Distant homology and being a little pregnant - http://bytesizebio.net/index...
Bruno C. Vellutini, Mickey Schafer, Allyson Lister and Neil Saunders liked this
I especially like the first comment on that post :)
- Allyson Lister
There are papers out there that discuss "functional orthologues".
- Roland Krause
Here's the NCBI on sequence homology, orthology, paralogy...http://www.ncbi.nlm.nih.gov/Educati...
- Neil Saunders
Thanks to everyone for all the live commentary! In return, I give you a Wordle cloud based on all the comments that were posted in this room :-)
Eleni Mikroyannidi, Frank, Piotr Byzia and 15 other people liked this
Surprised 'Allyson' is not one of the large keywords :)
- Oliver Hofmann
from iPhone
I used only the comments themselves - not the names of the people who posted them
- Lars Juhl Jensen
Maybe make a Wordle out of the contributors?
- Cameron Neylon
Did someone spot the 'Open' yet?
- Egon Willighagen
Cameron, contributors cloud done and posted :)
- Lars Juhl Jensen
I see a homologous word in the two Wordles! Latin data = Sanskrit datta, "given". :-)
- Ruchira S. Datta
@Oliver - to answer your question there are a number of "@" names in the wordle, if you look closely, but yeah, it's very nice of @Lars to do both wordles! I can see @allyson and @oliver for instance
- Allyson Lister
Looks like we should ramp up our vocabulary of verbs - use, using and used are all prominent items by themselves.
- Roland Krause
I'm amazed by the difference between the Wordle based on abstracts (http://larsjuhljensen.tumblr.com/post...) and this one. The abstracts seem to focus on methods whereas the FriendFeed comments focus on data.
- Lars Juhl Jensen
At least partially because it is much easier to quickly describes test data set than a complex method that might require notation or a schema, I think
- Oliver Hofmann
from iPhone
Wordle contributors cloud v2 (now with first and last names concatenated)
Allyson Lister, Nakao M., Venkata P. Satagopam and 9 other people liked this
Ally comes in at a suprising second by my eyes!
- Frank
Apologies to those of you with foreign characters in your names, which got mangled by Wordle :-/
- Lars Juhl Jensen
you can use a tilde to keep words together but maintain the space http://www.wordle.net/faq#spa...
- Simon Cockell
Frank, me too! I wonder if this Wordle excluded the non talk specific things (e.g., FF shut us down)
- Ruchira S. Datta
No it was just a quick'n'dirty hack: download all comments as JSON in batches of 30 topics, extract FriendFeed user names, paste into Wordle, submit to FriendFeed ;-)
- Lars Juhl Jensen
Now you know how to order the authors when you write up the meeting :-)
- Neil Saunders
well, that would probably explain it then :-)
- Ruchira S. Datta
I don't think so Ruchira - the distance from Ally to you is more than 150 comments. I doubt you made *that* many non-talk comments (but I haven't checked).
- Lars Juhl Jensen
Simon, thanks - I won't pester people with a v3 of this cloud, though ;-)
- Lars Juhl Jensen
Think Allyson (and to some extent I) switched to the blog posts and stopped pasting over comments to ff when coverage was already good -- and Ruchira, your coverage was fast and incredibly thorough :)
- Oliver Hofmann
I demand that the analysis is normalized by comment length! And mean attendance! And complexity of the presented material! And smileys!
- Roland Krause
@Roland you are very funny! If you want to know my hypotheses, then: @Ruchira should be first for FF comments, as she definitely ramped up her commenting over the week, even including the SIG comments (which I guess were included :)); also, as @Oliver says, both of us mainly switched to blog posts as the week went on, especially for talks where other FFers were about. I'm not demanding that Lars re-write to pull down word counts from comments or blog posts, though :) (But it would be interesting! :D)
- Allyson Lister
HL57: Erik Sonnhammer - FunCoup: global networks of functional coupling in eukaryotes
How to reconstruct networks - experimental networks are incomplete.
- Roland Krause
Up to 300.000 interactions are proposed for human
- Roland Krause
only 35000 known
- Ruchira S. Datta
Each experimental method can give you more than 20% of the interactions.
- Roland Krause
experiments have high false negative and false positive rates
- Ruchira S. Datta
e.g., false positives from in vitro experiments: the interaction may never happen in a living cell
- Ruchira S. Datta
Interactions have to be combined and evaluated.
- Roland Krause
FunCoup
- Venkata P. Satagopam
there are many kinds of evidence for functional coupling
- Ruchira S. Datta
Lots of evidence for functional coupling, not only from PPI but als from localization, gene expresson, interacting domain, TFBS; miRNAs.
- Roland Krause
domain interactions
- Venkata P. Satagopam
See also http://ff.im/4xrCV
- Ruchira S. Datta
Integrate different kind of data from various organisms.
- Roland Krause
Some links are continous, some binary, etc.
- Roland Krause
using Naive bayesian training
- Venkata P. Satagopam
full Bayesian training would be too computationally heavy
- Ruchira S. Datta
Naive Bayesian training, going from continuous data to distinct bins.
- Roland Krause
compare with positive and negative reference datasets
- Ruchira S. Datta
There is no negative reference data set out there, genes in different compartment might actually interact.
- Roland Krause
therefore use random examples as negative set
- Ruchira S. Datta
calculate enrichment as likelihood ratio=P(+)/P(-)
- Venkata P. Satagopam
Learn log likelihoiod ratios for each evidence, requires large negative set.
- Roland Krause
sum all the log-likelihood ratios to get full bayesian score
- Ruchira S. Datta
4 different flavors of training sets: metabolic pathway, signaling pathway, physical ppi, and complexes from UniProt
- Ruchira S. Datta
Training sets are from KEGG (metabolic and signaling), HPRD and Complexes from Uniprot.
- Roland Krause
using the curated data only for training/validation, not as input to the networks
- Ruchira S. Datta
No curated data used in the network, only in training.
- Roland Krause
7 model organisms and human are combined with 50 individual data sets.
- Roland Krause
Convert log scores to confidence scores.
- Roland Krause
predict coupling between 2 genes, for each model FC-PI, FC-CM, FC-ML, FC-SL model
- Venkata P. Satagopam
convert into confidence scores, which may be different in different models
- Ruchira S. Datta
convert the Bayesian score using the probabilitly of functional coupling, which is unknown but they just set to 1/1000 ad hoc
- Ruchira S. Datta
algorithmic innovations- we have to develop new evidence scores
- Venkata P. Satagopam
Used input from PPI as continuous data, using experimental counts.
- Roland Krause
discretization caused problems
- Ruchira S. Datta
they figured out how to discretize
- Ruchira S. Datta
test significance with chi-squared test
- Ruchira S. Datta
integrate evidence from orthologs used by InParanoid
- Ruchira S. Datta
using inparanoid orthologs
- Venkata P. Satagopam
Used transfer of ortholougs information under the same Bayesian framework
- Roland Krause
new phylogenetic patterns using orthologs
- Ruchira S. Datta
Except for yeast, most species had more information transferred rather than generated for the organism.
- Roland Krause
most support coming other species, other wise we may miss
- Venkata P. Satagopam
many links would not have been found without evidence from other species
- Ruchira S. Datta
only yeast is well supported all by itself
- Ruchira S. Datta
validated networks, TCGARN science 2008
- Venkata P. Satagopam
Validation using cancer pathways, recovering 29 of 36 links, found an additional 25. Not entirely independent.
- Roland Krause
Independent validation from recovering tumour mutation sets.
- Roland Krause
applications - 1 . exploring local networks, 2. analyzing network conservation
- Venkata P. Satagopam
3?
- Venkata P. Satagopam
Easy exploration of the data sources leading to an edge in the network.
- Roland Krause
graph visualization: started with Medusa, but it didn't fulfill needs
- Ruchira S. Datta
now developed JSquid (sp?), published last year
- Ruchira S. Datta
used jSquid .. Bioinformatics 2008
- Venkata P. Satagopam
New view of the human disease network, build tree of disease interactions.
- Roland Krause
conclusions
- Venkata P. Satagopam
to discover novel functional coupling between genes
- Venkata P. Satagopam
Cancers group together, neurological diseases do not.
- Roland Krause
can expand gene sets such as pathways
- Venkata P. Satagopam
(only to get the blog on top of the ISCB portal site; the figures messed up our layout)
- Reinhard Schneider
HL61: Lee Newberg - Global Measures of Uncertainty: Long Overdue in Computational Molecular Biology
Neil Saunders liked this
two papers: webb-robertson & lawrence; newberg ... lawrence
- Michael Kuhn
what is a good e-value?
- Diego M. Riaño-Pachón
E- and p-values are small when random data in unlikely to do well
- Michael Kuhn
E-values and p-values tell you about random data but not whether there are other solutions.
- Roland Krause
but there still might be other solutions which equally good E or p values
- Michael Kuhn
need to define confidence / credibility limits
- Michael Kuhn
e-values and p-values are poor proxies to credibility
- Diego M. Riaño-Pachón
an example from RNA 2D prediction, MFE is not the best representative
- Diego M. Riaño-Pachón
today's goal: compute a global measure of representativeness of a point estimate
- Michael Kuhn
solution spaces are immense, but we often choose a particular point estimate... misleading e.g. if there's a bimodal solution
- Michael Kuhn
Goal: Compute global mesaure of representativeness of a point estimate
- Peter Menzel
Related publications: http://www.ncbi.nlm.nih.gov/pubmed...; http://www.ncbi.nlm.nih.gov/pubmed...
- Diego M. Riaño-Pachón
Many problems are tackled by dynamic programming, HMMS, etc, collectively they are Hidden Boltzmann Models
- Roland Krause
compute / estimate credibility: look at distribution of differences from point estimate
- Michael Kuhn
SW alignment of nt sequences, score distribution can be modeled by exponential distribution. For a 3000x3000 alignment, the Fourier approach is fast.
- Roland Krause
Will not explain all about Fourier Transform (in 15 minutes).
- Roland Krause
use the credibility limit, is a simple number, even a biologist can understand that
- Diego M. Riaño-Pachón
(only to get the blog on top of the ISCB portal site; the figures messed up our layout)
- Reinhard Schneider
FFers open thread
Pierre Lindenbaum, Cass Johnston, Nakao M. and 6 other people liked this
I'm here and will be attending the BioPathways SIG. I figured there should be some place to say non-talk-specific things like "I've arrived!", so here it is.
- Ruchira S. Datta
Will be switching between DAM, BOSC and the BioPathways. Once I've figured out which talk is when ;)
- Oliver Hofmann
Uhoh. I sense a lack of places to recharge notebooks. This is going to be fun during the session breaks..
- Oliver Hofmann
I forsee a problem with the SIG posts in FF - only one heading, and many, many speakers.... Hopefully will be OK for people following.
- Allyson Lister
The projectionist kindly suggested I power up in the projection cubicle during the coffee break.
- Ruchira S. Datta
Network is slowing down to a crawl for me.
- Oliver Hofmann
Sitting at home, following the conference. Great job folks! My only wish is that there was some place where the speakers would upload their presentations.
- Lars Juhl Jensen
Help! Anyone got a UK plug adaptor with them I could borrow for an hour or so? Will happily exchange laptop charge for beer/coffee.
- Cass Johnston
Oliver, I've been having that problem too. There were some times when I had posted a comment and wanted to post another one, but the first hadn't finished posting, so I had to wait for the post to finish, hold my comment in my head, and also pay attention to what the speaker was currently saying...
- Ruchira S. Datta
Talked to the organizers. They are aware of the problem, IT is looking into increasing bandwidth. Yay.
- Oliver Hofmann
@Oliver well done! Perhaps we could ask someone to look into more power extension leads? :)
- Allyson Lister
Anyone up for a FF lunch / dinner / drink at some point during ISMB?
- Oliver Hofmann
Sounds good. I'm about to go orienteering, though, so will be out of reach this evening...
- Ruchira S. Datta
Monday and Tuesday are the only "free" nights, with poster sessions going from 5:45 to 8:30 pm. Shall we just set Monday night for the FF meet-up? When would people want to leave the conference at the earliest? 8 pm?
- Michael Kuhn
Monday's going to be busy meeting everyone; I'd probably try and stick around 'till 8pm. Meet at the registration booth close to the entrance at 8:15? Can decide on a venue depending on our numbers and whether people are willing to travel to the city center.
- Oliver Hofmann
I think I would prefer 8:40. I have a poster. I haven't figured out yet whether it's Monday or Tuesday, but others might have posters too? Last year, at least, I was explaining my poster to people pretty much constantly until the poster session closed.
- Ruchira S. Datta
Monday or Tuesday is good for me - either way, and any time is fine. It's a good idea!
- Allyson Lister
8:45 on Monday then, same place (registration area)? Do we have any locals with suggestions?
- Oliver Hofmann
ok - see you all in registration at 8:45 monday :)
- Allyson Lister
If everyone has already seen Gamla Stan by that time, we could go to Södermalm--plenty of good restaurants. I'm staying there.
- Ruchira S. Datta
@Ruchira: works for me as long as we have a guide to get us there :)
- Oliver Hofmann
@Allyson There are lots of power extensions along the windows just inside the T hall. Let me know if those are still too full and I'll see what I can do about getting more.
- Dave Messina
@Oliver The conference organizers have bought high-speed internet. Anyone can go to the registration desk for a free login. Spread the word!
- Dave Messina
@Dave, yep, got mine this morning. World of a difference.
- Oliver Hofmann
@Dave, any chance of getting extension cords to the other conference rooms? Starved for outlets at K21 :)
- Oliver Hofmann
I'll be arriving today, would it be worth to pack a extension cords with multiple sockets?
- Roland Krause
@Roland: This is always a good idea. Problem is that some rooms only have power on the stage and in the projection booth.
- Michael Kuhn
Organizers also have extra extension cords for emergencies, but even the main conference room has no outlets. Best to recharge during the breaks, but that means leaving the notebook unattended...
- Oliver Hofmann
photos from ISMB/ECCB, please put on flickr under tag "ismbeccb2009"
- Burkhard Rost
The projectionist here just unplugged my power cord from their outlet and said none of us will be allowed to use their outlet; we'll need to use the outlets in Hall C. He said the organizers did not pay for extra outlets, so we will still have this power problem.
- Ruchira S. Datta
Well, at least I'll be able to sit closer to the front where I can see better.
- Ruchira S. Datta
Even the "free" network is considerably faster and more responsive today. Well… we'll see what happens when the first coffee break hits.
- Johann Visagie
@Ruchira: Ouch. That's not going to help. We can get extension cords and use them in the smaller meeting rooms though.
- Oliver Hofmann
@Johann agreed - I also think the network is faster today
- Allyson Lister
I love the fierce, ofttimes violent competition for the limited resource that is power outlets during coffee break!
- Johann Visagie
It seems a simple #ismb is the twitter hashtag of choice. Also note Burkhard's suggestion above to use "ismbeccb2009" as Flickr tag. (Hey! Flickr tags can has spaces! ;)
- Johann Visagie
@Johann: Bring your own socket multiplier and you are loved by everyone ;-)
- Oliver Hofmann
Any chance of leaving / recharging our desktops at the registration desk during the breaks? Would rather not leave mine in a conference room unattended.
- Oliver Hofmann
Lonely FFer near the registration desk is looking for some chatting... anyone?
- Egon Willighagen
Sure, I'll wander by momentarily.
- Ruchira S. Datta
I'm sitting on the ground in front of the registration desk, waering a black t-shirt...
- Egon Willighagen
Any poster presenters here on FriendFeed? Maybe you can start a new post in the ISMB/ECCB room and attach your poster PDF?
- Egon Willighagen
Great idea, Egon! Not being at the conference, I would very much appreciate being able to see some of the posters on FF.
- Lars Juhl Jensen
Lars, are you in Stockholm?
- Egon Willighagen
What about special sessions, I do not see them here.
- Diego M. Riaño-Pachón
I'm having a special FF sessions outside, but I am the only participant :) (after a nice meet up with Ruchira earlier)
- Egon Willighagen
@Egon - shame - I was offline for lunch. At least I assume it was lunch you said that. FF doesn't put up the time each comment was made - so add times please if you're talking about meetups! Hopefully see most of you this evening after the poster session anyway :)
- Allyson Lister
P.S. The network seems to have slowed down again. Anyone else notice, or is it just me?
- Allyson Lister
@Dave thanks for the power extension cable - except for the main victoria hall (as we discussed) it's really helped a lot :)
- Allyson Lister
@Allysin, I'm still around... in front of E.A.T. now....
- Egon Willighagen
@Egon - ah, but I'm in a talk! :)
- Allyson Lister
@Egon, no I decided not to go this year
- Lars Juhl Jensen
@Allyson: As half of the conference is probably sharing the username / password for the closed network I am not surprised it is slowing down :)
- Oliver Hofmann
Maybe it is because I am happily uploading Jmol 11.7.45 to SourceForge ? :)
- Egon Willighagen
@Allyson Glad to help!
- Dave Messina
@Oliver Hopefully it's that rather than someone downloading Genbank. :) Still plenty of FREE logins for the closed wifi are available at the registration desk for anyone who wants one.
- Dave Messina
Fun to see how quickly many of us have found a workaround for the 'Oops'... :)
- Egon Willighagen
Is there a place for posting jobs/student positions available to ISMB attendees? (i.e. http://tinyurl.com/brinkma...) I'm not at the ISMB this year, so am definitely checking out FF and related resources and thank you all for your posts!
- Fiona Brinkman
Does anyone know how to 'filter out' all group:ismbeccb2009 messages in my main feed? So that I can just open the ISMB/ECCB 2009 group in a separate window?
- Egon Willighagen
Thanks to everyone - organizers, reviewers, presenters, friends, bloggers etc etc etc : I must away, but had loads of fun! :)
- Allyson Lister
@Allyson, safe travels. @all, see you in Boston. Feel free to PM/mail me for tips where to stay, eat or party in the city.
- Oliver Hofmann
nice meeting you, Allyson, and have a safe trip!
- Ruchira S. Datta
I am leaving too, was nice meeting you all and have a good trip back.
- Roland Krause
Conference finally closed.
- Peter Menzel
i'm now at the Stockholm airport en route to Cambridge for another conference (!) http://www.functionalgenomics.org.uk/section... It was fun meeting some of you and microblogging together. Hope we'll see each other around at future conferences. Next year in Boston!
- Ruchira S. Datta
@Egon: if you go to the ismbeccb09 room and click the "(edit)" link to the right of "Lists" then you can deselect it from your Home feed.
- Lars Juhl Jensen
A top-ten of talks (well, not really - just the top ten of my ISMB posts based on number of hits). What was everyone interested in enough to click through to my blog? Find out: http://themindwobbles.wordpress.com/2009...
- Allyson Lister
HL54: Mona Singh - Search and discovery of recurring patterns with interactomes
Neil Saunders liked this
Hairballs.
- Roland Krause
Different large scale data sets, genetic, phosphorylation etc. exist but how to interpret?
- Roland Krause
Add protein annotatons, sequence, structure, motifs, domains, functional characterization.
- Roland Krause
Particular interested in interaction domains, analyzing cellular organization and interactomes. Can we discover and analyze recurring patterns.
- Roland Krause
Analogy to multiple alignment of protein sequences with PROSITE pattern
- Roland Krause
For networks schemas, nodes are description of proteins, e.g. domains. An extension of network by attributes, e.g. PFAM or PROSITE.
- Roland Krause
Examples for network schema are homologous pathways.
- Roland Krause
Netgrep has visual interface.
- Roland Krause
No details of the algorithm, tricky problem but can solve it fast.
- Roland Krause
Triangles, quad topology (linear combination of four), Y star topology of four.
- Roland Krause
Automatically discovery of overrepresented schemas with direct interactions and sequence motifs. Using Y2H with filtering to address quality of the data set.
- Roland Krause
Counting occurrences of labelled subgraphs, brute force approach using Netgrep.
- Roland Krause
score each possible schema
- Ruchira S. Datta
count how frequently it occurs, but different annotations have different frequencies
- Ruchira S. Datta
need to account for overrepresentation
- Ruchira S. Datta
Some annotations are more frequent than other, score has to incorporate both the frequency.
- Roland Krause
Randomized network
- Roland Krause
take each network, randomize it, count how often the annotation occurs in the randomized network and compute the overrepresentation term
- Ruchira S. Datta
Estimate false discovery rate, look at features with FDR < 0.05
- Roland Krause
count how often the score occurs in the random graph, to estimate the false discovery rate
- Ruchira S. Datta
when making the random graph with the pair schemas, preserve degree
- Ruchira S. Datta
for triplet schemas, also preserve annotation
- Ruchira S. Datta
For 3-vertex schemas, need to presever pairwise annotation acounts.
- Roland Krause
for higher order schemas, also preserve triplets
- Ruchira S. Datta
used Stub Wiring from Uri Alon's group for randomizing the pairwise schema
- Ruchira S. Datta
no known algorithm for randomizing uniformly, need to approximate
- Ruchira S. Datta
151 pairwise schema [...]
- Roland Krause
do the proteins making up these schemas share biological processes?
- Ruchira S. Datta
Hypergeometric evaluation of schemas.
- Roland Krause
check enrichment versus background
- Ruchira S. Datta
Graph of the pairwise schema network.
- Roland Krause
For triplets, nodes are themselves pairwise schemas.
- Roland Krause
Hubs in the graph are ras, kinas and [...]
- Roland Krause
cross-interactomics: repeated the process in human
- Ruchira S. Datta
Example of the DUP family in yeast, and pair comparison between human and yeast.
- Roland Krause
Human-specific schemas, some consist of domains that also exist in yeast.
- Roland Krause
Q. Robustness of the resulting networks. A. Removed 5%, found the network to be stable. Different results in different organisms.
- Roland Krause
Q. Use of subgraph sampling? A. Can use any topology for searches.
- Roland Krause
# Not sure I understand the question and answer but they do.
- Roland Krause
Q. (Ruchira) Human-yeast network did you check orthology? A. Used PFAM annotation, did not worry about orthology. Some motifs in human are from the expansion.
- Roland Krause
HL51: Jüri Reimand - GraphWeb: functional analysis of genomic networks
A tool for large, genome scale networks is applied to yeast data.
- Roland Krause
The modular nature of molecular cell biology can be seen in today's large networks. A broad overview over the different, complex networks.
- Roland Krause
Many biological entities can be seen as networks, e.g. proteins and genes, measured by DNA binding, physical and genetic interactions, which can be combined into heterogenous networks.
- Roland Krause
Edges are not born equal, we need edge-weights, easy in gene expression networks. SAGA and SWI/SNF example. Assign local weights to rank edges in the network
- Roland Krause
Data set are not born equal. Small scale data set are more reliable than global approaches.
- Roland Krause
# Not sure I agree fully here, but he is merely motivating the weights approach.
- Roland Krause
Some data set are trusted more than others.
- Roland Krause
Different scores for global and local weights can be combined.
- Roland Krause
Hairball.
- Roland Krause
Everything is interconnected, no way to interpret. Needs to be dissected.
- Roland Krause
Cliques, hubs, set of neighbors can be used to find the modules. Graph clustering are unsupervised approaches, using MCL or between centrality clustering.
- Roland Krause
Functional enrichment can be studied using miRNAs, KEGG, Reactome, GO, TFBS.
- Roland Krause
The statistical perspective can be computed by hypergeometric tests, could be normalized with the number of proteins in the module.
- Roland Krause
Graph partitioning to detect dense regions, than enrichment, only highlight those with high scores.
- Roland Krause
Analyze public data set from yeast, breaking down into hub based modules.
- Roland Krause
Ah, the proteasome.
- Roland Krause
Interacting with YHB1, probably makes sense to a yeast biologist.
- Roland Krause
Available online at http://biit.cs.ut.ee/graphweb/
- Roland Krause
Export to cytoscape for visualizaition.
- Roland Krause
An Estonia endeavor (Postdoc positions open)
- Roland Krause
PT47: Oliver Stegle - Predicting and Understanding the Stability of G-Quadruplexes
Roland Krause liked this
G-Quadruplexes are stable structures of RNA and DNA
- Roland Krause
Typically of the from GGGACTAAGGGACTTCCCACTTGG
- Roland Krause
Will form spontaneously, have role in transcriptional control and telomeres.
- Roland Krause
Are these patterns really stable? It's the first indicator of a functional role. Melting temp will be a proxy for stability
- Allyson Lister
Overrepresented in promoter regions [Hupper and Balasumbramanian, 2007]
- Roland Krause
Melting temperature can be predicted and experimentally verified. It's low throughput though, rules are limited, complicated non-linear relationships.
- Roland Krause
Gaussian processes (GP) regression with different error rates across the sequence.
- Roland Krause
Gives the posterior distribution of function values given a training set.
- Roland Krause
Needs a covariance function (kernel), a likelihood model and hyperparameters.
- Roland Krause
Product ansatz to construct a joint covariance function of concentration and sequence.
- Roland Krause
Uses common k-mer substrings.
- Roland Krause
Use the squared distance of the sequence features such as composition, length of spacers etc.
- Roland Krause
these structures are so stable sometimes they never melt.
- Allyson Lister
Training data is noisy with outliers, sometimes only gives a bound.
- Roland Krause
Non-Gaussian likelihood model is robust, incorporates observations as bounds.
- Roland Krause
Hyperparameters estimated either with MAP or MCMC sampling.
- Roland Krause
they look at 260 quadruplexes (one of the first data sets available for quadruplexes)
- Allyson Lister
Dataset with 260 G-quadruplexes, compared to SVMs and GPs.
- Roland Krause
GPs outperform SVMs in mean squared error and mean log probability.
- Roland Krause
Gives confidence in the prediction.
- Roland Krause
With a 50/50 training split, the predictions (with the error bars) always overlap with the "truth" line, sometimes with a large uncertainty. Everything is predicted within 10 degrees C.
- Allyson Lister
The relevance of the features for the hyperparameters can be shown, one of the length parameters is most important.
- Roland Krause
Genome-wide GQ prediction in human identifies 359,548 candidate sequences.
- Roland Krause
60% is in the 10° Tm range (which is pretty good).
- Roland Krause
Are they functional and in promoter regions?
- Roland Krause
Quadruplexes are overrepresented in the promoter regions by order of magnitude than anywhere else
- Allyson Lister
Weak hint, may not to be expected much more from only 260 examples.
- Roland Krause
Just about significant.
- Roland Krause
Future work includes further biological validation.
- Roland Krause
Blog post: http://themindwobbles.wordpress.com/2009... (Interesting talk - some of it was a little over my head though!)
- Allyson Lister
My question: Are GQs connected to high-GC promoters? A. Only further validation will tell.
- Roland Krause
PT45: Hamid Reza Chitsaz - A Partition Function Algorithm for Interacting Nucleic Acid Strands
Daniel Swan and Roland Krause liked this
First part presented by Raheleh Salari
- Roland Krause
Increased interest in RNA-RNA interaction prediction requires computational target prediction.
- Roland Krause
ncRNAs bind to mRNA and regulate translation, including the specificity etc.
- Roland Krause
Several models have been described, e.g. PairFold, RNAhybrid, RNAup, IRIS, InteRNA.
- Roland Krause
Problem np-complete
- Roland Krause
All current approaches do not include the probability and stability of the joint secondary structure.
- Roland Krause
Interaction energy model and interaction partition function over all SS without pseudoknots or crossing interactions and zigzags.
- Roland Krause
The standard model by Matthews et al (1999) assumes an energy model with independence between hairpins, bulges etc.
- Roland Krause
More than one loop-loop interaction in a real example, ignore interhybrid loop, other loops termed kissing loops.
- Roland Krause
# that was a little fast
- Roland Krause
A kissing loop is intramolecular loop that makes interaction with the other strand.
- Roland Krause
Give the energy functions for the new structures for the interaction partition function.
- Roland Krause
Second part given now by Hamid Chitsaz
- Roland Krause
Main interest in the strength and stability of the RNA interaction, which is challenging because all structures must be accounted for exactly once.
- Roland Krause
Make use of a dynamic programming approach using divide and conquer. Compute the partition function for bits of the structure.
- Roland Krause
McCaskill's algorithm (1990) is introduced, describing a participation function for single strands.
- Roland Krause
For two unpaired strands, McCaskill's algorithm can be used directly,
- Roland Krause
98 cases need to be considered, not even in the paper but in the suppl. mat.
- Roland Krause
# sounds like a complicated model, it's not completely presented
- Roland Krause
Explanation for the no-zig zag assumption motivated by less running time, one arch describes them all.
- Roland Krause
Can predict the equilibrium concentaion, the melting temperature and the UV absorption.
- Roland Krause
Presented algorithm (piRNA) outperforms existing ones by an order of magnitude, experimental validation with Tm shows little deviation.
- Roland Krause
Algorithm is available.
- Roland Krause
PT43: Tobias Marschall - Efficient Exact Motif Discovery
Marcel Martin and Roland Krause liked this
Unsupervised motif discovery on a string with no previous knowledege in an automated fashion.
- Roland Krause
issues: How to measure over-representation and how to find them.
- Roland Krause
184 publications in pubmed for "motif discovery algorithm"
- Roland Krause
aim to establish an (almost) exact method based on a rigorous motif statistics
- Mikhail Spivakov
given: query text, IUPAC motifs, random text model (background) - for now, iid
- Mikhail Spivakov
Calculating a p-value of a given query text, a IUPAC motif and a random text model.
- Roland Krause
want: a p-value for a motif
- Mikhail Spivakov
use a novel device called probabilistic arithmetic automata - won't go into details
- Mikhail Spivakov
Need to compute the distribution of occurrences by chance. Not a straight forward task, recently proposed a new approach by building a probabilistic arithmetic automata.
- Roland Krause
an exact calculation
- Mikhail Spivakov
The problem is that computing p-values is infeasible due to large number of motifs.
- Roland Krause
matches occur in clumps. use compound possion approximation (almost exact) to calculate exact distribution of clump sizes. approximate number of clumps by Poisson distribution
- Mikhail Spivakov
Use of a Compound Poisson Approximation on a set of clumps (sets of overlapping motifs)
- Roland Krause
clump = overlapping occurences
- Marcel Martin
The clump size can be used the probabilistic atutomata.
- Roland Krause
nice: clumP SIze is abbreviated with an uppercase psi
- Marcel Martin
How to bound the p-value to prune the search space?
- Roland Krause
bound no. of occurences using the no. of clumps
- Marcel Martin
p-value: the probability of observing >k occurences (when found k in the real data)
- Mikhail Spivakov
Motifs with the same composition have the same expectation.
- Roland Krause
iterate over all possible compositions, not over the motifs themselves to take advantage of the same expectation
- Marcel Martin
but iid model for DNA isn't very appropriate
- Mikhail Spivakov
Use of a suffix tree of the sequence, iterate over the motifs, use the lower bound for pruning, walk the tree and identify overrepresented motifs.
- Roland Krause
so re-evaluate the motifs producing a good p-value with iid on a Markovian text model
- Mikhail Spivakov
designing a good benchmark set is hard
- Marcel Martin
other tools: Weeder, MEME
- Marcel Martin
Benchmark sets are not easy, used a set by Sandve et al. http://www.pubmedcentral.nih.gov/article...
- Roland Krause
Outperforms Weeder and MEME at the cost of higher running time of ~12 hours.
- Roland Krause
algorithm is not as fast as the other tools. is easily parallelizable
- Marcel Martin
with a 4.4 Mbp genome of M.tuberculosis, found motifs in ~250 CPU hrs in a parallelized setting
- Mikhail Spivakov
best motif: AGACSCARAA (or sth like that), found in literature
- Marcel Martin
computationally demanding, but possible with modern computers
- Mikhail Spivakov
List of models, the first is described, others are under investigation.
- Roland Krause
in the future: use modern hardware (eg GPUs)
- Mikhail Spivakov
optimise wrt Markovian models directly (rather than iid)
- Mikhail Spivakov
Future work could incorporate Markovian models directly or use phylogenetic information.
- Roland Krause
Q. Is the implementation available? A: Given in the paper.
- Roland Krause
question: is the tool available? yes, URL in the paper
- Marcel Martin
you have to take into account overlapping motifs for doing proper statistics
- Marcel Martin
Q. Are the data in Jasper or Transfac? A. Had an expert looking at it.
- Roland Krause
# Jasper and Transfac do not really cover Mycobacterium motifs
- Roland Krause
Q: Performance of the algorithm on short motifs. A. Length 10 is the upper bound for the algorithm which is quite dependent on the length.
- Roland Krause
Q: applying to protein models? A: problematic because alphabet is larger and indels would need to be modelled
- Marcel Martin
Q: how is the iid text model? how do you justify that the text fulfills the model? A: the iid model is estimated from the text. dependencies between characters are incorporated by using the Markovian model
- Marcel Martin
Q. (Marcel Schulz) Differences in Markov models of different orders. A. Shorter orders give spurious results.
- Roland Krause
Q: why only a part of the motif space? A: tried to come up with a plausible set that includes most motifs
- Marcel Martin
PT41: Shai Lubliner - Modeling Interactions between Adjacent Nucleosomes Improves Genome-wide Predictions of Nucleosome Occupancy
James Taylor, Mike Chelen and Roland Krause liked this
Nucleosome position affects transcriptional regulation, models for position are required for understanding of TR.
- Roland Krause
75-90% of the DNA is associated with nucleosomes, play an important regulatory role.
- Oliver Hofmann
Use a recently published model to produce the affinity landscape, showing the suitability of nucleosome occupancy.
- Roland Krause
Genomic nuceosome affinity landscape based on a thermodynamical model
- Oliver Hofmann
The model is probably published here (http://www.ncbi.nlm.nih.gov/pubmed...)
- Roland Krause
Can interactions between nucleosomes introduced into the model?
- Roland Krause
Two kinds of interactions: direct or bridged by transcription factors or other proteins.
- Roland Krause
Additional interactions are important for chromatin organization. DNA bending proteins, TF, histone modifications, etc.
- Oliver Hofmann
First approach focuses on direct interaction, including the distance between the nucleosomes.
- Roland Krause
Trying to capture interactions between adjacent nucleosomes (cooperative effects)
- Oliver Hofmann
What types of functions can represent cooperativity types?
- Roland Krause
Notable features include a right shifted main peak, followed by exponential decay.
- Roland Krause
Tested Exponential, Stepped Exp, S-ES, Stepping-Off and Stepping-On
- Roland Krause
Sampled 5000 configurations and compared it to the linker length preference.
- Roland Krause
Can the model properly learned?
- Roland Krause
Repeat with data samples, add noise and try to fit different models to the sampled occupancy landscape
- Oliver Hofmann
Used synthetic data, including experimental noise, then forgot the algorithm to generate the data and used the previously described models.
- Roland Krause
Exponential function shows a good correlation in five-fold cross-validation, with the model incorporating the interaction outperforming the ones without.
- Roland Krause
Are the interactions relevant in vivo and in vitro?
- Roland Krause
For an in vitro validation the Exp, Step functions work better than the no cooperativity model
- Oliver Hofmann
Short linker lengths are favored.
- Roland Krause
Interactions are also important using in vivo data, data from several chromosomes and different organisms (yeast and C. elegans) show similar results.
- Roland Krause
The interesting part -- biological basis for this preference?
- Oliver Hofmann
The in vitro system consists of nucleosomes and DNA only.
- Roland Krause
shorter length may allow for interaction of nucleosomes, energetically favoring their shift from otherwise better binding positions
- Oliver Hofmann
Hypothesis: electrostatic interaction between nucleosomes, which has been described previously but not shown in the data.
- Roland Krause
# Surprised that the very model was not presented in the talk.
- Roland Krause
# Wonder whether there is a difference between promoters, other nucleosome covered regions (or other genomic subsets); with the role nucleosome displacement plays in regulation I'd expect some shift
- Oliver Hofmann
Blog notes: http://www.fiamh.info/article...
- Oliver Hofmann
Q: When you started motivating the model, there was a peak at 10 but the sample data did not have that.[?] A: These are effects of histone H1, which are not modeled. There are a lot of question marks about the role of H1 in yeast. The interaction that we modeled are global and can occur anywhere on the DNA. More complex model would incorporate additional local effects, e.g. other factors.
- Roland Krause
Q. Have you finished the model for the higher eukaryotes: A The model is independent of the organism. There might be differences, although this is debated. Differnces between yeast and human are known.
- Roland Krause
Birds of a Feather session: Beyond microblogging, Wednesday, 1pm confirmed.
Daniel Mietchen, Mickey Kosloff, James Taylor and 8 other people liked this
Thanks for setting this up, @Roland!
- Allyson Lister
Some thoughts I've had: Pre-annotation of papers and posters prior to the meeting, as is done by David Shotton in "Adventures in Semantic Publishing: Exemplar Semantic Enhancements of a Research Article" at http://dx.doi.org/10... . Don't think it's automated, but you get the idea - and David Shotton gave a talk here this week (http://ff.im/4xwI9) ; and also Reflect (http://ff.im/4yVO1)
- Allyson Lister
Also, how should scientists start with microblogging and social networking? http://themindwobbles.wordpress.com/2009...
- Allyson Lister
Let's meet for the 4.15 coffee break at the coffee bar in front of K1, @Allyson and other interested people. If you have ideas, it would be good to prepare them.
- Roland Krause
sounds good :)
- Allyson Lister
http://ff.im/4BEXJ might also be of interest (Utopia )
- Allyson Lister
I COMPLETELY forgot about the meetup at coffee today! I'm sooo sorry! Was anything decided? Can you put up any summary points that might be of interest tomorrow? My apologies!
- Allyson Lister
@Allyson: Wednesday. It's Tuesday :o)
- Oliver Hofmann
@Oliver - I missed the pre-BOF meetup today at 4:15 at coffee - see above... :(
- Allyson Lister
Oh. I did not even SEE that comment. Sigh.
- Oliver Hofmann
No problem, we can meet over nibbles at the reception now. I can tell you what I have in mind.
- Roland Krause
@Roland - I'm afraid I'm not available this evening. Morning? Or just write your ideas here? I'm a dork - sorry! :)
- Allyson Lister
This should not take long at all, but please leave your ideas here. This is going to be an interactive session anyway, so we don't have to be all that prepared. My slides are more of a moderation prop than a standalone presentation.
- Roland Krause
I would like to have some meta-discussion: why are we live blogging? How is this useful and how can we make it more useful? Does it mainly benefit those not attending the meeting or is it also useful as an archive of what has been said?
- Michael Kuhn
from iPod
Which room the BoF takes place?
- Peter Menzel
In addition to what Michael Kuhn (@biocs) said, meeting microblogging can also benefit the presenter - giving them valuable feedback. Also links posted to papers, websites, etc. are great, to easily view more info about what someone is/was talking about.
- Fiona Brinkman
I'll miss this, due to my time difference (Can. west coast) but I look forward to all your thoughts and thank you for setting this BoF up!
- Fiona Brinkman
@Fiona - we'll make sure to post (maybe microblog!) the BoF :) Thanks for your input - benefits to the presenter is a really good point.
- Allyson Lister
Last year at ISMB, even though I was already on FF I took notes as I habitually do, with calligraphic fountain pen. During the course of the intervening year I would find myself trying to refer back to those notes while in conversation with others, but had difficulty finding what I wanted in time.
- Ruchira S. Datta
Paradoxically, I perceive myself as being slower when taking notes electronically than by hand (I think I tend to spend more time formulating them). But since we're doing this cooperatively, if one of us doesn't catch something another will. The notes will be searchable any time on the web; I won't have to dig up a particular file on a particular computer. The same effort provides the same resource for others.
- Ruchira S. Datta
I did revert to the fountain pen at various points this year though! It's more reliable than depending on the availability of power, wireless, and FriendFeed.
- Ruchira S. Datta
@Peter - the ISMB website tells me we will be in C8 for this session
- Allyson Lister
The BioSysBio 2009 conference report (http://genomebiology.com/2009...) just came out (disclaimer, I'm an author). Simon Cockell had a wordle used (http://www.flickr.com/photos...), and FF and Twitter get a mention, if a short one: "A new feature for BioSysBio 2009 to extend participation in the conference was to a wider audience by communicating live...
more...
- Allyson Lister
Roland, where is the BoF going to be?
- Michael Kuhn
The location is still given as C8.
- Roland Krause
Set up an Etherpad for collaborative note taking: http://etherpad.com/EOOgB1Y27Z
- Oliver Hofmann
I will be there from 12:40 onwards, if you have left suggestions here, please be there a little earlier for a quick roundup.
- Roland Krause
Getting started. Mini-overview of past/current/future
- Oliver Hofmann
Disclaimer for presentations -- what is allowed and what isn't (mail, blogging, film...)
- Oliver Hofmann
Reference to Cameron Neylon's logos for presenters: http://blog.openwetware.org/science...
- Allyson Lister
A need to make presenters aware of what might be distributed how
- Oliver Hofmann
Reference to CSHL and recent "controversy": http://scienceblogs.com/genetic...
- Allyson Lister
Conference blogging ideas from nature: http://www.nature.com/news...
- Allyson Lister
Brief discussion of CSHL controversy
- Oliver Hofmann
Journalists and bloggers should abide by the same rules at a conference - whatever those rules are
- Allyson Lister
Classical blog posts, twitter and friendfeed: surprising how effective friendfeed is given it's basic nature
- Oliver Hofmann
Find it quite difficult to make sense out of Twitter (best - wordle aka Simon Cockell?)
- Allyson Lister
Oliver says FF isn't perfect, but it does have a very low barrier to access and start using
- Allyson Lister
Where do personal opinions come into it? In general at ISMB we are all being polite. What level is acceptable?
- Allyson Lister
Roland: the discussion culture in science has changed a litle. He read that 50 years ago they were having much more open discussions
- Allyson Lister
Maybe people might be away from the conference and following remotely, or at the conference and shy - such people could pose questions on friendfeed, and then chair (who is monitoring FF) could ask them at the end of the talk
- Allyson Lister
Differences to last year: increased depth of coverage (due to ISCB support, raised awareness?)
- Oliver Hofmann
We all thanked the organisers from this year
- Allyson Lister
ISMB people (Reinhard?) will do some basic stats of the coverage of this conference
- Allyson Lister
Many of us bloggers feel that the first to benefit are ourselves
- Allyson Lister
First person to benefit from blogging: the blogger
- Oliver Hofmann
Live blogging especially useful for keynotes - for recording the presenter's thoughts.. and not always an accompanying paper available.. ?
- Peter Menzel
Andrew: heavily blogged talks are more useful for external people than delegates
- Allyson Lister
liveblogging is complementary to webcast etc as it takes less time - if you like the liveblogging and the blog posts after scanning, then you go and look at webcast
- Allyson Lister
Also, people liveblogging tends to pick out the key points quickly
- Allyson Lister
webcasting also has many time and technical issues
- Allyson Lister
oliver: Perhaps much of the commenting is too sober. Not enough meta-information, e.g. "here is X's main competitor's paper..."
- Allyson Lister
it would be nice to have more background - yes
- Jim Procter
Roland: can you have two streams - one light, one serious. Allyson: but it would be difficult in practice, if you have to look at two different things
- Allyson Lister
Three levels: factual information/transcript. notes to self, public commentary / context
- Oliver Hofmann
Feeds are important feedback for the presenter ?
- Peter Menzel
technical issues: there can be issues with internet / wireless
- Allyson Lister
(Like right now?)
- Oliver Hofmann
@Oliver - yep! Back now, though :)
- Allyson Lister
Should we have TLAs or abbrevs to indicate personal comments or uncertainty? Maybe not TLAs (makes barrier for newbies) - how about single symbol at the beginning, e.g. '#' for personal comments
- Allyson Lister
We should write up a boilerplate: what it means to liveblog; if you don't want it, then... (e.g. logo from Cameron) ;why scientists should liveblog; *suggest* that your FF account should link to something that identifies you; you might want to consider only posting things that you would be happy saying to people's face.
- Allyson Lister
no legislation, though - don't want to force people to do anything
- Allyson Lister
ISMB will certainly do it next year
- Allyson Lister
imho: Official Facebook group etc. should be more advertised..
- Peter Menzel
@Peter - I agree - the embedded FF threads within the ISMB site were advertised, but more should have been made of them - it's quite cool to see!
- Allyson Lister
Some great points made here - thank you!
- Fiona Brinkman
see here for the Google Doc to make a write-up out of this discussion: http://docs.google.com/Doc...
- Michael Kuhn
PT32: Timothy O'Connor - Genotype-Phenotype Associations: Substitution Models to Detect Evolutionary Associations Between Phenotypic Variables and Genotypic Evolutionary Rate
Can we detect a change of rate in evolution. Model is sperm competition in apes.
- Roland Krause
Phylogeny is important to look at the independent signal, also use the past nodes for inference.
- Roland Krause
Problems arise from the use of extant taxa and neglecting internal states. Trying to map the rate of evolution using Markov Models, including the error of the internal state reconstruction.
- Roland Krause
Independent and dependent Q-matrices are introduced.
- Roland Krause
Several szenarios for primate sperm competition, split into low and high cases, looked at 13 candidate genes and 2 controls, more than in the submitted paper. Model slightly modified by setting W1> W0.
- Roland Krause
The known gene SEMG2 stands out after multiple testing corrections, other genes not that dramatically.
- Roland Krause
Current work on the electron transport chain to look into max lifespans and body size, referring to the metabolic and the longevity hypotheses.
- Roland Krause
Metabolic hypothesis slightly supported, ongoing work.
- Roland Krause
It's a first model that incorporates rate changes in genotype-phenotype associations.
- Roland Krause
Q: For this method, what is the statistical power (sensitivity)? A: Typically, its fairly sensitive.
- Roland Krause
Q: Do more data improve the quality? A: Yes.
- Roland Krause
PT30: Daniel Huson - Computing Galled Networks from Real Data
Two different types, networks that provide an explicit picture with hybridization etc, or an abstract network.
- Roland Krause
An early approach using a mathematical generalization were split networks, which provide an abstraction but no explanation.
- Roland Krause
See dendroscope.org
- Roland Krause
Go to an explicit networks where you have hybridization and speciation events, e.g. in plant evolution, horizontal gene transfer in bacteria. Both appear similar in this framework.
- Roland Krause
When modelling reticulate evolution a node can have a variable input from different parents, e.g. 50/50 for plants, 95/5 for horizontal gene transfer settings.
- Roland Krause
BoF: Protein-protein interaction and evolution:
Quantifying the probability of gain and loss of interactions.
- Roland Krause
New, noisy interaction can arise relatively quickly, probabilities for gain and loss should be in the same order of magnitude.
- Roland Krause
HL24: Jason McDermott - Discovery of a hidden sequence motif conserved in the bacterial type III secretion signal: implications for structure, drug discovery and host-pathogen systems models.
Salmonella typhimurium is the main model organism for this work. It builds its own niche using the T3SS in the macrophages, kills many people each year. In the US, it's mainly a food pathogen.
- Roland Krause
Good model system for Salmonella typhi, the agent of typhus, a narrow range human pathogen.
- Roland Krause
Includes two T3SS, injecting effectors into the host cell. 47 known effectors.
- Roland Krause
Problems in T3SS, consisting of the injectosome and the secreted effectors, is the remote homogy of the efffectors. N-terminus of the effectors required for secretion but no similarity could be found.
- Roland Krause
Typically not part of the 3D structure, appears to be disordered. How could the diverse sequences have the same function? Different mechanism ´for every effector? Cognate chaperones help the effectors to thread the protein into the injectosome. But you can delete the chaperone.
- Roland Krause
Hypothesis for this talk: There is a common mechanism in the effectors. Typically BLAST was used to identify the secretion family.
- Roland Krause
Previous analysis have been working for some organisms but not across species. The group developed a machine learning method (SVMs) from the primary sequence, including the nt-.sequence and used an unaligned input of the sequence. Used Pseudomonas syringae with 35 known effectors. Used the rest of the genome as negative examples.
- Roland Krause
ROC is in the 0.05 range.
- Roland Krause
Applied this to Chlamydia trachomatis, an almost untractable obligate intracellular pathogen.
- Roland Krause
A similar paper appeared back to back with this paper, another paper was published recently. http://www.ncbi.nlm.nih.gov/pubmed...
- Roland Krause
Identification of a T3SS motif by in silico mutagenesis.
- Roland Krause
Experimental validation is in the making.
- Roland Krause
3D-prediction of the N-terminus, using a variety of 3Dand 2D-structure prediction methods and disorder prediction. Found a little initial beta-sheet followed by a short helix.
- Roland Krause
NMR and CD data being analyzed.
- Roland Krause
Systems biology approach, looking into transcription and regulation, network topology studies ties in nicely with the effectors work, being at the interface of two networks in host and pathogen.
- Roland Krause
HL22: Dannie Durand - Sequence Similarity Network Reveals Common Ancestry of Multidomain Proteins
Ruchira S. Datta, Lars Juhl Jensen, Jason Stajich and arne liked this
Multidomain proteins are difficult to categorize because different parts have different histories.
- Gabriele Sales
Multidomain homolgs - finding homologs is an important aspect of functional genomics.
- Roland Krause
Song et al 2008 PLoS Computational Biology 4(5)
- Allyson Lister
Genes that share common ancestry tend to have similar structure and function.
- Gabriele Sales
also use to build comparative map of synteny
- Ruchira S. Datta
Sequence comparison can be used to identify chromosomal regions that share common ancestry.
- Gabriele Sales
this is called "spatial genomics"
- Ruchira S. Datta
How multidomain proteins fit this picture?
- Gabriele Sales
Example tyrosine kinases associated with many different domains.
- Roland Krause
example: protein tyrosine kinases
- Ruchira S. Datta
one family with many domain architectures, all sharing a kinase domain
- Ruchira S. Datta
Multidomain sequences evolve via gene duplication and domain shuffling.
- Gabriele Sales
multidomain sequences evolve via gene duplication and domain shuffling
- Ruchira S. Datta
The same domain may appear in multiple, unrelated proteins.
- Gabriele Sales
A definition will be presented that is in line with Fitch' proposition of homology.
- Roland Krause
can have case where genes share common ancestry, but domain architecture has changed
- Ruchira S. Datta
Difference between sequences related by vertical descent and related by domain insertion.
- Roland Krause
Two kinds of relations among genomes: relation by vertical descent or relation by domain insertion.
- Gabriele Sales
similarly can have the converse: through domain shuffling, genes that are not homologous can come to have the same domain architecture
- Ruchira S. Datta
It is possible to distinguish such two cases?
- Gabriele Sales
Given two sequences with similarity: Can one distinguish the two szenarios?
- Roland Krause
homologs are related by vertical descent
- Ruchira S. Datta
orthologs are related by speciation
- Ruchira S. Datta
orthologs are a subset of homologs, and homologs intersect with the set of significantly similar sequences
- Ruchira S. Datta
also have distant homologs which don't appear to be significantly similar
- Ruchira S. Datta
A Venn diagram, including orthologs, homologs, distant homologs and significantly similar sequences with modification.
- Roland Krause
inferences that can be drawn from vertical descent (similar molecular functions) and domain insertion (bindng partners) are different
- Allyson Lister
Biological interpretation of vertical descent: molecular function; regulation; comparative mapping; processes of gene duplication and genome rearrangement.
- Gabriele Sales
Interpretations of domain insertion: protein specialization; ligand specificity; localization; process of domain shuffling.
- Gabriele Sales
vertical descent implies similar: molecular function, regulation, comparative mapping, and is useful for processes of duplication and genome rearrangement
- Ruchira S. Datta
domain insertion leads to relationships of protein specialization, ligand binding, and cellular localization
- Ruchira S. Datta
In animals and plants multidomain sequences become more important than in bacteria.
- Gabriele Sales
The more higher eukaryotes will be sequenced, the more the problem needs to be addressed.
- Roland Krause
therefore, among similar sequences, want to distinguish which are related by vertical descent, and which by domain insertion
- Ruchira S. Datta
people look at sequence similarity E-value, and at alignment coverage
- Ruchira S. Datta
Alignment length is typically used to distinguish domain re-arrangements. Needs a decent mode model.
- Roland Krause
Good example that sequence similarity or e-values are not capable of distinguishing the two caes.
- Roland Krause
The goal of this method is to identify sequence pairs related by VD and DI,and should work on a broad range of families
- Allyson Lister
And needs to be computationally feasible.
- Roland Krause
To test, they looked at 20 well-studied families related by vertical descent.
- Allyson Lister
They had a much larger set of negative examples (40,000).
- Allyson Lister
PSI-BLAST performs worse then BLAST for sequences with variable architecture multi-domain proteins(!) as it pulls in non-homologous parts of sequences.
- Roland Krause
All methods do well with conserved multidomain proteins. They were more challenged by Variable multidomain, where Psi-BLAST doesn't do as well as BLAST. Both methods are extremely challenged when all the sequences were put into the analysis together.
- Allyson Lister
Pairwise comparisons are not sufficient. Try networks instead.
- Gabriele Sales
Pairwise sequences might not be enough, use the structure of the similarity networks.
- Roland Krause
Two sequences are compared in the context of their respective neighborhoods (i.e. other sequences that show similarity).
- Gabriele Sales
Domain architecture is implicitly present in the network.
- Allyson Lister
Open question. The model is explicitly based on insertion and deletion. What about de novo sequence formation?
- Gabriele Sales
Comment by Kevin Karplus: Use log scale for false positives in the ROC plots.
- Roland Krause
Other ways to read this feed:
